Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413709145:

Variant ID: vg0413709145 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13709145
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTGTCTACTTTGATATCGTATCGTATAGATCCTCGTACCAACGTACCTCAATACACATTTTATCCGGTCTACAGGTATCCCCCATCGACAGTGGTG[C/T]
GCCAGGTAGGGGACTTTGGTGCTCAAGGTTCTGCCGACATGACTTCAAGCCGCTCCGACAACTTCATCTACATCGGCCCCAATGCAGGAGATCCAACCTC

Reverse complement sequence

GAGGTTGGATCTCCTGCATTGGGGCCGATGTAGATGAAGTTGTCGGAGCGGCTTGAAGTCATGTCGGCAGAACCTTGAGCACCAAAGTCCCCTACCTGGC[G/A]
CACCACTGTCGATGGGGGATACCTGTAGACCGGATAAAATGTGTATTGAGGTACGTTGGTACGAGGATCTATACGATACGATATCAAAGTAGACAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 6.70% 3.47% 0.00% NA
All Indica  2759 98.80% 0.10% 1.09% 0.00% NA
All Japonica  1512 71.00% 20.30% 8.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.30% 0.00% 2.69% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 0.10% 1.65% 0.00% NA
Temperate Japonica  767 50.10% 35.60% 14.34% 0.00% NA
Tropical Japonica  504 96.80% 1.20% 1.98% 0.00% NA
Japonica Intermediate  241 83.80% 11.60% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 7.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413709145 C -> T LOC_Os04g23980.1 upstream_gene_variant ; 2345.0bp to feature; MODIFIER silent_mutation Average:62.653; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0413709145 C -> T LOC_Os04g23990.1 downstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:62.653; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0413709145 C -> T LOC_Os04g23980-LOC_Os04g23990 intergenic_region ; MODIFIER silent_mutation Average:62.653; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0413709145 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413709145 NA 5.00E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 4.69E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 1.30E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 2.30E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 3.96E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 1.87E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 3.48E-06 NA mr1154_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 7.58E-07 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 4.33E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 9.02E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 7.19E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 3.76E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 1.47E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 5.96E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413709145 NA 6.62E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251