Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413685186:

Variant ID: vg0413685186 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13685186
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGAGTTTTTGCCATGGCTGCTAGGTTTTCAACTAAGCCTCATGTTTTCGATGGAACTGATTTTTCTCATGGTGTAGTAGGATGCAATCTTACATTATG[A/G]
CTGAGGATTATGATATTCGGAGAAAAGTCAAATCCTTATGTGATTCCTGAACAAATTAATACTGCTCCTTTAAAAACTGAATTTGAACAAAATTACAAAG

Reverse complement sequence

CTTTGTAATTTTGTTCAAATTCAGTTTTTAAAGGAGCAGTATTAATTTGTTCAGGAATCACATAAGGATTTGACTTTTCTCCGAATATCATAATCCTCAG[T/C]
CATAATGTAAGATTGCATCCTACTACACCATGAGAAAAATCAGTTCCATCGAAAACATGAGGCTTAGTTGAAAACCTAGCAGCCATGGCAAAAACTCTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	30.20%	0.02%	0.00%	NA
All Indica	2759	98.50%	1.40%	0.04%	0.00%	NA
All Japonica	1512	11.90%	88.10%	0.00%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	2.00%	98.00%	0.00%	0.00%	NA
Tropical Japonica	504	17.90%	82.10%	0.00%	0.00%	NA
Japonica Intermediate	241	31.10%	68.90%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413685186	A -> G	LOC_Os04g23930.1	upstream_gene_variant ; 268.0bp to feature; MODIFIER	silent_mutation	Average:26.571; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N
vg0413685186	A -> G	LOC_Os04g23940.1	downstream_gene_variant ; 4796.0bp to feature; MODIFIER	silent_mutation	Average:26.571; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N
vg0413685186	A -> G	LOC_Os04g23920-LOC_Os04g23930	intergenic_region ; MODIFIER	silent_mutation	Average:26.571; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413685186	NA	4.11E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	NA	1.89E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	NA	1.82E-34	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	NA	1.39E-20	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	NA	7.79E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	NA	2.59E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	NA	2.62E-29	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	3.10E-06	5.61E-11	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	NA	2.70E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	6.36E-06	4.46E-19	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	2.63E-09	1.74E-10	mr1730_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	NA	9.48E-16	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413685186	3.44E-06	2.05E-06	mr1866_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251