Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413556513:

Variant ID: vg0413556513 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13556513
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CTATACTGCAATATGTAGCAACGTACTTGCACGAACATGTATGCTGATTCCTGACCGTCTGGTCGCGAAATCTGGCGGATGGACCAGATTCGTCTCACAC[G/T]
ATCGTCCGGAAAAATCACCCGCGCGAACCATTGATCCTATCCCACCACGTACCGATCGACCCCACTCATCCAATCGTACTTCCTGCCTTGCCCGATGACG

Reverse complement sequence

CGTCATCGGGCAAGGCAGGAAGTACGATTGGATGAGTGGGGTCGATCGGTACGTGGTGGGATAGGATCAATGGTTCGCGCGGGTGATTTTTCCGGACGAT[C/A]
GTGTGAGACGAATCTGGTCCATCCGCCAGATTTCGCGACCAGACGGTCAGGAATCAGCATACATGTTCGTGCAAGTACGTTGCTACATATTGCAGTATAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.80%	3.40%	1.33%	3.41%	NA
All Indica	2759	93.10%	0.20%	0.98%	5.69%	NA
All Japonica	1512	87.60%	10.30%	2.05%	0.07%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	96.50%	0.00%	0.84%	2.69%	NA
Indica II	465	88.80%	0.60%	1.72%	8.82%	NA
Indica III	913	93.40%	0.20%	0.55%	5.81%	NA
Indica Intermediate	786	92.70%	0.10%	1.15%	5.98%	NA
Temperate Japonica	767	97.50%	1.80%	0.65%	0.00%	NA
Tropical Japonica	504	74.40%	22.00%	3.57%	0.00%	NA
Japonica Intermediate	241	83.80%	12.40%	3.32%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	2.20%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413556513	G -> DEL	N	N	silent_mutation	Average:84.092; most accessible tissue: Callus, score: 99.152	N	N	N	N
vg0413556513	G -> T	LOC_Os04g23700.1	upstream_gene_variant ; 1180.0bp to feature; MODIFIER	silent_mutation	Average:84.092; most accessible tissue: Callus, score: 99.152	N	N	N	N
vg0413556513	G -> T	LOC_Os04g23700-LOC_Os04g23710	intergenic_region ; MODIFIER	silent_mutation	Average:84.092; most accessible tissue: Callus, score: 99.152	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0413556513	G	T	-0.14	-0.08	-0.04	-0.01	-0.08	-0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413556513	NA	3.07E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	7.01E-06	2.77E-07	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	NA	3.31E-07	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	1.88E-06	NA	mr1070_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	1.75E-06	NA	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	4.07E-06	NA	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	2.07E-07	5.49E-06	mr1104_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	1.75E-07	7.65E-09	mr1155_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	2.55E-07	3.58E-09	mr1224_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	NA	8.97E-08	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	NA	2.96E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	1.32E-06	NA	mr1408_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	9.67E-07	3.75E-06	mr1437_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413556513	1.91E-06	2.40E-07	mr1620_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251