Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413443781:

Variant ID: vg0413443781 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13443781
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATTTTATTAATGACGATATCACATTTTTTACTAGTAATGGTAATGTATTTAGATTAACGAGATGTTAATAGACCAATAAACGAAATTATTGACCACTC[T/A]
TTATTAATCAAATGCAAATAATTTAATTCGTTCATTACATATAATTTGGAAATGTACGTCCATAATGTACTATACATCTACAACTACATGAAAGGTCTTC

Reverse complement sequence

GAAGACCTTTCATGTAGTTGTAGATGTATAGTACATTATGGACGTACATTTCCAAATTATATGTAATGAACGAATTAAATTATTTGCATTTGATTAATAA[A/T]
GAGTGGTCAATAATTTCGTTTATTGGTCTATTAACATCTCGTTAATCTAAATACATTACCATTACTAGTAAAAAATGTGATATCGTCATTAATAAAATAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	8.40%	0.13%	0.00%	NA
All Indica	2759	94.90%	5.00%	0.04%	0.00%	NA
All Japonica	1512	88.40%	11.40%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	84.90%	15.00%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.70%	4.30%	0.00%	0.00%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	80.80%	19.00%	0.20%	0.00%	NA
Japonica Intermediate	241	73.90%	25.30%	0.83%	0.00%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413443781	T -> A	LOC_Os04g23510.1	downstream_gene_variant ; 4399.0bp to feature; MODIFIER	silent_mutation	Average:13.955; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N
vg0413443781	T -> A	LOC_Os04g23510-LOC_Os04g23520	intergenic_region ; MODIFIER	silent_mutation	Average:13.955; most accessible tissue: Zhenshan97 flower, score: 28.855	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413443781	3.92E-06	7.05E-08	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	8.69E-07	2.87E-08	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	7.59E-06	NA	mr1185	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	3.99E-07	4.01E-08	mr1185	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	NA	8.08E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	NA	8.20E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	8.97E-06	NA	mr1912	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	2.40E-07	3.43E-09	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	NA	4.65E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	NA	1.39E-06	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	7.19E-08	NA	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	3.73E-06	2.43E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781	1.04E-06	NA	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251