\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413443781:

Variant ID: vg0413443781 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13443781
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTTTATTAATGACGATATCACATTTTTTACTAGTAATGGTAATGTATTTAGATTAACGAGATGTTAATAGACCAATAAACGAAATTATTGACCACTC[T/A]
TTATTAATCAAATGCAAATAATTTAATTCGTTCATTACATATAATTTGGAAATGTACGTCCATAATGTACTATACATCTACAACTACATGAAAGGTCTTC

Reverse complement sequence

GAAGACCTTTCATGTAGTTGTAGATGTATAGTACATTATGGACGTACATTTCCAAATTATATGTAATGAACGAATTAAATTATTTGCATTTGATTAATAA[A/T]
GAGTGGTCAATAATTTCGTTTATTGGTCTATTAACATCTCGTTAATCTAAATACATTACCATTACTAGTAAAAAATGTGATATCGTCATTAATAAAATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 8.40% 0.13% 0.00% NA
All Indica  2759 94.90% 5.00% 0.04% 0.00% NA
All Japonica  1512 88.40% 11.40% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.90% 15.00% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 80.80% 19.00% 0.20% 0.00% NA
Japonica Intermediate  241 73.90% 25.30% 0.83% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413443781 T -> A LOC_Os04g23510.1 downstream_gene_variant ; 4399.0bp to feature; MODIFIER silent_mutation Average:13.955; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N
vg0413443781 T -> A LOC_Os04g23510-LOC_Os04g23520 intergenic_region ; MODIFIER silent_mutation Average:13.955; most accessible tissue: Zhenshan97 flower, score: 28.855 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413443781 3.92E-06 7.05E-08 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 8.69E-07 2.87E-08 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 7.59E-06 NA mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 3.99E-07 4.01E-08 mr1185 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 NA 8.08E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 NA 8.20E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 8.97E-06 NA mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 2.40E-07 3.43E-09 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 NA 4.65E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 NA 1.39E-06 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 7.19E-08 NA mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 3.73E-06 2.43E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413443781 1.04E-06 NA mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251