Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413435949:

Variant ID: vg0413435949 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13435949
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTGCATAAAGCTAGCATTTAAAAACAGTAGTTGAAAGCAGTAAAACAGTTGTAGTGATTAATCAATATTAACCAATCACTGCTCAACGCTACACCAC[G/A,T]
TTGAGTCAGGCCCAAACCACCACCTGAACTAACCAGTTCCATTAGCTAACTAGGGGTGAGACTAACCACGGTGAATCTGGTCGACCGCCCATAACCGCGG

Reverse complement sequence

CCGCGGTTATGGGCGGTCGACCAGATTCACCGTGGTTAGTCTCACCCCTAGTTAGCTAATGGAACTGGTTAGTTCAGGTGGTGGTTTGGGCCTGACTCAA[C/T,A]
GTGGTGTAGCGTTGAGCAGTGATTGGTTAATATTGATTAATCACTACAACTGTTTTACTGCTTTCAACTACTGTTTTTAAATGCTAGCTTTATGCAAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 8.50% 0.04% 0.00% NA
All Indica  2759 94.90% 5.00% 0.07% 0.00% NA
All Japonica  1512 88.40% 11.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.20% 14.80% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.60% 1.30% 0.11% 0.00% NA
Indica Intermediate  786 95.50% 4.30% 0.13% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 80.80% 19.20% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413435949 G -> A LOC_Os04g23510.1 upstream_gene_variant ; 3074.0bp to feature; MODIFIER silent_mutation Average:69.244; most accessible tissue: Zhenshan97 flag leaf, score: 86.673 N N N N
vg0413435949 G -> A LOC_Os04g23500.1 intron_variant ; MODIFIER silent_mutation Average:69.244; most accessible tissue: Zhenshan97 flag leaf, score: 86.673 N N N N
vg0413435949 G -> T LOC_Os04g23510.1 upstream_gene_variant ; 3074.0bp to feature; MODIFIER N Average:69.244; most accessible tissue: Zhenshan97 flag leaf, score: 86.673 N N N N
vg0413435949 G -> T LOC_Os04g23500.1 intron_variant ; MODIFIER N Average:69.244; most accessible tissue: Zhenshan97 flag leaf, score: 86.673 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0413435949 G A 0.0 0.0 0.0 0.0 0.0 0.0
vg0413435949 G T -0.02 -0.02 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413435949 NA 1.46E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 2.35E-06 2.67E-06 mr1043 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 NA 5.78E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 2.31E-06 4.55E-06 mr1185 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 NA 1.16E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 NA 9.38E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 9.15E-06 NA mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 7.22E-06 1.77E-07 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 NA 8.61E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 1.65E-09 NA mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 NA 3.64E-09 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 NA 8.04E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 NA 2.77E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413435949 5.09E-06 NA mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251