\
| Variant ID: vg0413435802 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13435802 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 340. )
ACCTCTTCGAGACATCTCCAACTGAGAAGAACTTCAACTCTGGTGTAGGGGAAAAGAGAGCAAGACTGAGTACTACCCACTGTACTCAGCAAGTCATACC[G/A]
GAAGAGGAGGTATGATGCAGGATATATCCAAAGGAGGCTAAAGGTCCTTTTGCATAAAGCTAGCATTTAAAAACAGTAGTTGAAAGCAGTAAAACAGTTG
CAACTGTTTTACTGCTTTCAACTACTGTTTTTAAATGCTAGCTTTATGCAAAAGGACCTTTAGCCTCCTTTGGATATATCCTGCATCATACCTCCTCTTC[C/T]
GGTATGACTTGCTGAGTACAGTGGGTAGTACTCAGTCTTGCTCTCTTTTCCCCTACACCAGAGTTGAAGTTCTTCTCAGTTGGAGATGTCTCGAAGAGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.40% | 8.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 94.90% | 5.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.00% | 15.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.60% | 19.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.90% | 26.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413435802 | G -> A | LOC_Os04g23510.1 | upstream_gene_variant ; 3221.0bp to feature; MODIFIER | silent_mutation | Average:65.501; most accessible tissue: Zhenshan97 flag leaf, score: 83.994 | N | N | N | N |
| vg0413435802 | G -> A | LOC_Os04g23500.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.501; most accessible tissue: Zhenshan97 flag leaf, score: 83.994 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413435802 | NA | 7.06E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413435802 | 2.52E-07 | NA | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413435802 | NA | 3.45E-09 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413435802 | NA | 1.11E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413435802 | 2.63E-07 | NA | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413435802 | 2.25E-06 | 9.76E-08 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413435802 | NA | 7.76E-06 | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413435802 | 1.39E-07 | NA | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413435802 | NA | 7.01E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413435802 | 3.27E-06 | 3.27E-06 | mr1983_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |