Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0413426647:

Variant ID: vg0413426647 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13426647
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

CTATATTTCGCAAGGGTAGGGCAGGGGGTATAGCCATGAGAGGCATCCTCTTCAGAACCGACATCGGCATCCTCCTCTTCCTCCTCCTCCCCATCACTTT[C/T]
GACGACGGCCTTCGTGCTACGGCAAGTTCGGATTTGGCCGCCTTTCACGATCGCACGCTTGCGTTTTCTCGAAGTGCCAGCCTCATCATCGCCGACCTGA

Reverse complement sequence

TCAGGTCGGCGATGATGAGGCTGGCACTTCGAGAAAACGCAAGCGTGCGATCGTGAAAGGCGGCCAAATCCGAACTTGCCGTAGCACGAAGGCCGTCGTC[G/A]
AAAGTGATGGGGAGGAGGAGGAAGAGGAGGATGCCGATGTCGGTTCTGAAGAGGATGCCTCTCATGGCTATACCCCCTGCCCTACCCTTGCGAAATATAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	5.70%	0.17%	3.62%	NA
All Indica	2759	99.70%	0.20%	0.00%	0.11%	NA
All Japonica	1512	71.80%	16.70%	0.53%	10.98%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	0.90%	0.00%	0.22%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	99.60%	0.30%	0.00%	0.13%	NA
Temperate Japonica	767	97.70%	2.10%	0.00%	0.26%	NA
Tropical Japonica	504	28.40%	39.90%	1.19%	30.56%	NA
Japonica Intermediate	241	80.50%	14.50%	0.83%	4.15%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	10.00%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413426647	C -> DEL	N	N	silent_mutation	Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0413426647	C -> T	LOC_Os04g23470.1	upstream_gene_variant ; 4655.0bp to feature; MODIFIER	silent_mutation	Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0413426647	C -> T	LOC_Os04g23480.1	downstream_gene_variant ; 2781.0bp to feature; MODIFIER	silent_mutation	Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0413426647	C -> T	LOC_Os04g23480-LOC_Os04g23500	intergenic_region ; MODIFIER	silent_mutation	Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413426647	NA	2.03E-08	mr1040	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	2.71E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	4.55E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	3.79E-23	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	5.31E-08	6.19E-22	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	1.15E-12	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	1.91E-09	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	1.76E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	4.88E-06	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	3.93E-06	NA	mr1040_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	3.70E-06	NA	mr1040_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	1.55E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	9.76E-06	NA	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	1.78E-07	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	5.31E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	7.22E-06	1.24E-08	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	4.64E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	8.58E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	1.01E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	1.61E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	1.01E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	4.03E-22	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	1.09E-20	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	6.41E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	3.16E-09	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	4.60E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647	NA	4.45E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251