\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413426647:

Variant ID: vg0413426647 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13426647
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


CTATATTTCGCAAGGGTAGGGCAGGGGGTATAGCCATGAGAGGCATCCTCTTCAGAACCGACATCGGCATCCTCCTCTTCCTCCTCCTCCCCATCACTTT[C/T]
GACGACGGCCTTCGTGCTACGGCAAGTTCGGATTTGGCCGCCTTTCACGATCGCACGCTTGCGTTTTCTCGAAGTGCCAGCCTCATCATCGCCGACCTGA

Reverse complement sequence

TCAGGTCGGCGATGATGAGGCTGGCACTTCGAGAAAACGCAAGCGTGCGATCGTGAAAGGCGGCCAAATCCGAACTTGCCGTAGCACGAAGGCCGTCGTC[G/A]
AAAGTGATGGGGAGGAGGAGGAAGAGGAGGATGCCGATGTCGGTTCTGAAGAGGATGCCTCTCATGGCTATACCCCCTGCCCTACCCTTGCGAAATATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 5.70% 0.17% 3.62% NA
All Indica  2759 99.70% 0.20% 0.00% 0.11% NA
All Japonica  1512 71.80% 16.70% 0.53% 10.98% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.00% 0.22% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 99.60% 0.30% 0.00% 0.13% NA
Temperate Japonica  767 97.70% 2.10% 0.00% 0.26% NA
Tropical Japonica  504 28.40% 39.90% 1.19% 30.56% NA
Japonica Intermediate  241 80.50% 14.50% 0.83% 4.15% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413426647 C -> DEL N N silent_mutation Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0413426647 C -> T LOC_Os04g23470.1 upstream_gene_variant ; 4655.0bp to feature; MODIFIER silent_mutation Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0413426647 C -> T LOC_Os04g23480.1 downstream_gene_variant ; 2781.0bp to feature; MODIFIER silent_mutation Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0413426647 C -> T LOC_Os04g23480-LOC_Os04g23500 intergenic_region ; MODIFIER silent_mutation Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413426647 NA 2.03E-08 mr1040 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 2.71E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 4.55E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 3.79E-23 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 5.31E-08 6.19E-22 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 1.15E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 1.91E-09 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 1.76E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 4.88E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 3.93E-06 NA mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 3.70E-06 NA mr1040_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 1.55E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 9.76E-06 NA mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 1.78E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 5.31E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 7.22E-06 1.24E-08 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 4.64E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 8.58E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 1.01E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 1.61E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 1.01E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 4.03E-22 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 1.09E-20 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 6.41E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 3.16E-09 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 4.60E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426647 NA 4.45E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251