\
| Variant ID: vg0413426647 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13426647 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )
CTATATTTCGCAAGGGTAGGGCAGGGGGTATAGCCATGAGAGGCATCCTCTTCAGAACCGACATCGGCATCCTCCTCTTCCTCCTCCTCCCCATCACTTT[C/T]
GACGACGGCCTTCGTGCTACGGCAAGTTCGGATTTGGCCGCCTTTCACGATCGCACGCTTGCGTTTTCTCGAAGTGCCAGCCTCATCATCGCCGACCTGA
TCAGGTCGGCGATGATGAGGCTGGCACTTCGAGAAAACGCAAGCGTGCGATCGTGAAAGGCGGCCAAATCCGAACTTGCCGTAGCACGAAGGCCGTCGTC[G/A]
AAAGTGATGGGGAGGAGGAGGAAGAGGAGGATGCCGATGTCGGTTCTGAAGAGGATGCCTCTCATGGCTATACCCCCTGCCCTACCCTTGCGAAATATAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 5.70% | 0.17% | 3.62% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.00% | 0.11% | NA |
| All Japonica | 1512 | 71.80% | 16.70% | 0.53% | 10.98% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 97.70% | 2.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 28.40% | 39.90% | 1.19% | 30.56% | NA |
| Japonica Intermediate | 241 | 80.50% | 14.50% | 0.83% | 4.15% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 10.00% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413426647 | C -> DEL | N | N | silent_mutation | Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0413426647 | C -> T | LOC_Os04g23470.1 | upstream_gene_variant ; 4655.0bp to feature; MODIFIER | silent_mutation | Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0413426647 | C -> T | LOC_Os04g23480.1 | downstream_gene_variant ; 2781.0bp to feature; MODIFIER | silent_mutation | Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0413426647 | C -> T | LOC_Os04g23480-LOC_Os04g23500 | intergenic_region ; MODIFIER | silent_mutation | Average:54.565; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413426647 | NA | 2.03E-08 | mr1040 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 2.71E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 4.55E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 3.79E-23 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | 5.31E-08 | 6.19E-22 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 1.15E-12 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 1.91E-09 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 1.76E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 4.88E-06 | mr1982 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | 3.93E-06 | NA | mr1040_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | 3.70E-06 | NA | mr1040_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 1.55E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | 9.76E-06 | NA | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 1.78E-07 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 5.31E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | 7.22E-06 | 1.24E-08 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 4.64E-07 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 8.58E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 1.01E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 1.61E-07 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 1.01E-06 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 4.03E-22 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 1.09E-20 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 6.41E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 3.16E-09 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 4.60E-06 | mr1668_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426647 | NA | 4.45E-07 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |