\
| Variant ID: vg0413426469 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13426469 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )
AGGGGTCCCGTCGGACCCTTCACTGTCCGAAAAGCCATGCCAAACCTGCACAACCTTCCCCTTCTTCTTTTTCCTTCTAACGGCCATCATCGGTTTCACG[G/A]
CCGTGCTGGAAATCACCAAAAGGGTGTTCGCCACGACGATATCCTATGGCCGCGTAGGCGAAACGTGCGAGCCTGCACTATATTTCGCAAGGGTAGGGCA
TGCCCTACCCTTGCGAAATATAGTGCAGGCTCGCACGTTTCGCCTACGCGGCCATAGGATATCGTCGTGGCGAACACCCTTTTGGTGATTTCCAGCACGG[C/T]
CGTGAAACCGATGATGGCCGTTAGAAGGAAAAAGAAGAAGGGGAAGGTTGTGCAGGTTTGGCATGGCTTTTCGGACAGTGAAGGGTCCGACGGGACCCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.70% | 5.40% | 0.13% | 2.77% | NA |
| All Indica | 2759 | 95.30% | 4.00% | 0.11% | 0.58% | NA |
| All Japonica | 1512 | 88.60% | 6.10% | 0.20% | 5.09% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.40% | 11.90% | 0.34% | 2.35% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 3.90% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 98.00% | 1.30% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 80.80% | 10.70% | 0.20% | 8.33% | NA |
| Japonica Intermediate | 241 | 75.10% | 11.60% | 0.41% | 12.86% | NA |
| VI/Aromatic | 96 | 24.00% | 40.60% | 0.00% | 35.42% | NA |
| Intermediate | 90 | 83.30% | 12.20% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413426469 | G -> DEL | N | N | silent_mutation | Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199 | N | N | N | N |
| vg0413426469 | G -> A | LOC_Os04g23470.1 | upstream_gene_variant ; 4477.0bp to feature; MODIFIER | silent_mutation | Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199 | N | N | N | N |
| vg0413426469 | G -> A | LOC_Os04g23480.1 | downstream_gene_variant ; 2603.0bp to feature; MODIFIER | silent_mutation | Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199 | N | N | N | N |
| vg0413426469 | G -> A | LOC_Os04g23480-LOC_Os04g23500 | intergenic_region ; MODIFIER | silent_mutation | Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413426469 | NA | 1.49E-07 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | 3.51E-06 | 8.19E-08 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | 2.40E-06 | 2.20E-07 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | NA | 7.65E-06 | mr1479 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | 4.62E-07 | 6.19E-09 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | 2.18E-07 | NA | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | 6.46E-06 | 8.75E-10 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | NA | 2.73E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | 2.89E-08 | NA | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | 8.15E-07 | 3.71E-08 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413426469 | 7.76E-07 | NA | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |