\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413426469:

Variant ID: vg0413426469 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13426469
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGGTCCCGTCGGACCCTTCACTGTCCGAAAAGCCATGCCAAACCTGCACAACCTTCCCCTTCTTCTTTTTCCTTCTAACGGCCATCATCGGTTTCACG[G/A]
CCGTGCTGGAAATCACCAAAAGGGTGTTCGCCACGACGATATCCTATGGCCGCGTAGGCGAAACGTGCGAGCCTGCACTATATTTCGCAAGGGTAGGGCA

Reverse complement sequence

TGCCCTACCCTTGCGAAATATAGTGCAGGCTCGCACGTTTCGCCTACGCGGCCATAGGATATCGTCGTGGCGAACACCCTTTTGGTGATTTCCAGCACGG[C/T]
CGTGAAACCGATGATGGCCGTTAGAAGGAAAAAGAAGAAGGGGAAGGTTGTGCAGGTTTGGCATGGCTTTTCGGACAGTGAAGGGTCCGACGGGACCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 5.40% 0.13% 2.77% NA
All Indica  2759 95.30% 4.00% 0.11% 0.58% NA
All Japonica  1512 88.60% 6.10% 0.20% 5.09% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.40% 11.90% 0.34% 2.35% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 3.90% 0.13% 0.25% NA
Temperate Japonica  767 98.00% 1.30% 0.13% 0.52% NA
Tropical Japonica  504 80.80% 10.70% 0.20% 8.33% NA
Japonica Intermediate  241 75.10% 11.60% 0.41% 12.86% NA
VI/Aromatic  96 24.00% 40.60% 0.00% 35.42% NA
Intermediate  90 83.30% 12.20% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413426469 G -> DEL N N silent_mutation Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0413426469 G -> A LOC_Os04g23470.1 upstream_gene_variant ; 4477.0bp to feature; MODIFIER silent_mutation Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0413426469 G -> A LOC_Os04g23480.1 downstream_gene_variant ; 2603.0bp to feature; MODIFIER silent_mutation Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg0413426469 G -> A LOC_Os04g23480-LOC_Os04g23500 intergenic_region ; MODIFIER silent_mutation Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413426469 NA 1.49E-07 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 3.51E-06 8.19E-08 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 2.40E-06 2.20E-07 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 NA 7.65E-06 mr1479 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 4.62E-07 6.19E-09 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 2.18E-07 NA mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 6.46E-06 8.75E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 NA 2.73E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 2.89E-08 NA mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 8.15E-07 3.71E-08 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469 7.76E-07 NA mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251