Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0413426469:

Variant ID: vg0413426469 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13426469
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGGTCCCGTCGGACCCTTCACTGTCCGAAAAGCCATGCCAAACCTGCACAACCTTCCCCTTCTTCTTTTTCCTTCTAACGGCCATCATCGGTTTCACG[G/A]
CCGTGCTGGAAATCACCAAAAGGGTGTTCGCCACGACGATATCCTATGGCCGCGTAGGCGAAACGTGCGAGCCTGCACTATATTTCGCAAGGGTAGGGCA

Reverse complement sequence

TGCCCTACCCTTGCGAAATATAGTGCAGGCTCGCACGTTTCGCCTACGCGGCCATAGGATATCGTCGTGGCGAACACCCTTTTGGTGATTTCCAGCACGG[C/T]
CGTGAAACCGATGATGGCCGTTAGAAGGAAAAAGAAGAAGGGGAAGGTTGTGCAGGTTTGGCATGGCTTTTCGGACAGTGAAGGGTCCGACGGGACCCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	5.40%	0.13%	2.77%	NA
All Indica	2759	95.30%	4.00%	0.11%	0.58%	NA
All Japonica	1512	88.60%	6.10%	0.20%	5.09%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	85.40%	11.90%	0.34%	2.35%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	95.70%	3.90%	0.13%	0.25%	NA
Temperate Japonica	767	98.00%	1.30%	0.13%	0.52%	NA
Tropical Japonica	504	80.80%	10.70%	0.20%	8.33%	NA
Japonica Intermediate	241	75.10%	11.60%	0.41%	12.86%	NA
VI/Aromatic	96	24.00%	40.60%	0.00%	35.42%	NA
Intermediate	90	83.30%	12.20%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413426469	G -> DEL	N	N	silent_mutation	Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0413426469	G -> A	LOC_Os04g23470.1	upstream_gene_variant ; 4477.0bp to feature; MODIFIER	silent_mutation	Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0413426469	G -> A	LOC_Os04g23480.1	downstream_gene_variant ; 2603.0bp to feature; MODIFIER	silent_mutation	Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg0413426469	G -> A	LOC_Os04g23480-LOC_Os04g23500	intergenic_region ; MODIFIER	silent_mutation	Average:60.032; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413426469	NA	1.49E-07	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	3.51E-06	8.19E-08	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	2.40E-06	2.20E-07	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	NA	7.65E-06	mr1479	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	4.62E-07	6.19E-09	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	2.18E-07	NA	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	6.46E-06	8.75E-10	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	NA	2.73E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	2.89E-08	NA	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	8.15E-07	3.71E-08	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413426469	7.76E-07	NA	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251