\
| Variant ID: vg0413417765 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13417765 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 336. )
GGGAGGGCCAAGATCATAGCCACATCCTGTAGAGTGATGGTCATCTCACCACTGGGAAGATGGAAGCTGTGTGTCTCAGGCCTCCATCTGTCCACAAGTG[C/T]
TGTCAACGCAGGAGCGTTGAACACTGGCATTCCTCTGCTCACGACCAAGGCCACCCCGAGCAACCCGGCCGCCCTTAGGTACGGGATGTACCTATCGTCG
CGACGATAGGTACATCCCGTACCTAAGGGCGGCCGGGTTGCTCGGGGTGGCCTTGGTCGTGAGCAGAGGAATGCCAGTGTTCAACGCTCCTGCGTTGACA[G/A]
CACTTGTGGACAGATGGAGGCCTGAGACACACAGCTTCCATCTTCCCAGTGGTGAGATGACCATCACTCTACAGGATGTGGCTATGATCTTGGCCCTCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 9.70% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.30% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 71.00% | 28.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.10% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 0.40% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 25.80% | 73.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413417765 | C -> T | LOC_Os04g23470.1 | missense_variant ; p.Ala980Thr; MODERATE | nonsynonymous_codon ; A980T | Average:55.111; most accessible tissue: Minghui63 young leaf, score: 73.49 | benign |
0.383 |
DELETERIOUS | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413417765 | NA | 2.84E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 7.15E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 1.94E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 4.65E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 5.94E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 8.83E-06 | mr1982 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 5.93E-07 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 3.14E-07 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 9.23E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 2.07E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 1.67E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 1.44E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 1.30E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | NA | 1.15E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413417765 | 2.70E-06 | NA | mr1800_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |