\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413385665:

Variant ID: vg0413385665 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13385665
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCCTGCTGATGCGCTCGACCAATGTCGTCTGGTGTCCGCTGTTCGCGATCGTCGCTGTCGCGGCGGTTATGCCGATTACGGTGGTGTTGGTCTCCGTT[C/T]
GAGGGGCCTCCTCGATCTTCGCCCTCGCGATGTCGTGAAGAAACACGATGTCGGGAACGATTCTTGTTGTCTTGCGCGCGTCATGCTTCTCGGCGGCCAT

Reverse complement sequence

ATGGCCGCCGAGAAGCATGACGCGCGCAAGACAACAAGAATCGTTCCCGACATCGTGTTTCTTCACGACATCGCGAGGGCGAAGATCGAGGAGGCCCCTC[G/A]
AACGGAGACCAACACCACCGTAATCGGCATAACCGCCGCGACAGCGACGATCGCGAACAGCGGACACCAGACGACATTGGTCGAGCGCATCAGCAGGACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 7.90% 0.32% 0.23% NA
All Indica  2759 94.60% 4.70% 0.29% 0.40% NA
All Japonica  1512 88.00% 11.70% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.90% 14.60% 0.50% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 98.70% 0.50% 0.00% 0.77% NA
Indica Intermediate  786 94.70% 4.30% 0.51% 0.51% NA
Temperate Japonica  767 98.40% 1.30% 0.26% 0.00% NA
Tropical Japonica  504 86.30% 13.50% 0.20% 0.00% NA
Japonica Intermediate  241 58.50% 41.10% 0.41% 0.00% NA
VI/Aromatic  96 46.90% 52.10% 1.04% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413385665 C -> DEL LOC_Os04g23410.1 N frameshift_variant Average:55.208; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N
vg0413385665 C -> T LOC_Os04g23410.1 missense_variant ; p.Arg34Gln; MODERATE nonsynonymous_codon ; R34Q Average:55.208; most accessible tissue: Zhenshan97 young leaf, score: 83.623 unknown unknown TOLERATED 0.45

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413385665 NA 3.24E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 5.31E-06 NA mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 NA 2.44E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 NA 2.17E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 2.32E-06 8.87E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 9.53E-07 4.77E-06 mr1912 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 NA 1.85E-07 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 NA 5.34E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 NA 1.84E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 NA 6.84E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413385665 6.19E-06 NA mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251