\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413281650:

Variant ID: vg0413281650 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13281650
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.29, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


GACTAAAGATCAAATATGCCCGTTACCCTTTTGAACCGGGACTAAAGATCATCTTTAGCCCCGGTTTTTATTGCATCCGGGACTATTGTGGAAATCGGCC[A/G]
ACCGACGAAAGATGGTTTCTCCACCAGTGTGTAGGCGATGCATGGAAACAAACCCTCATACTCATTGCTTGCAGGCACACGAACTGTCTATGCTCACGGG

Reverse complement sequence

CCCGTGAGCATAGACAGTTCGTGTGCCTGCAAGCAATGAGTATGAGGGTTTGTTTCCATGCATCGCCTACACACTGGTGGAGAAACCATCTTTCGTCGGT[T/C]
GGCCGATTTCCACAATAGTCCCGGATGCAATAAAAACCGGGGCTAAAGATGATCTTTAGTCCCGGTTCAAAAGGGTAACGGGCATATTTGATCTTTAGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.00% 17.50% 1.31% 42.26% NA
All Indica  2759 19.50% 8.00% 1.85% 70.68% NA
All Japonica  1512 63.60% 35.40% 0.40% 0.60% NA
Aus  269 77.30% 18.20% 0.00% 4.46% NA
Indica I  595 35.80% 0.00% 6.39% 57.82% NA
Indica II  465 6.00% 24.70% 0.22% 69.03% NA
Indica III  913 17.30% 4.30% 0.22% 78.20% NA
Indica Intermediate  786 17.70% 8.40% 1.27% 72.65% NA
Temperate Japonica  767 96.60% 2.70% 0.39% 0.26% NA
Tropical Japonica  504 14.90% 84.30% 0.20% 0.60% NA
Japonica Intermediate  241 60.20% 37.30% 0.83% 1.66% NA
VI/Aromatic  96 93.80% 4.20% 2.08% 0.00% NA
Intermediate  90 50.00% 17.80% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413281650 A -> DEL N N silent_mutation Average:53.072; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0413281650 A -> G LOC_Os04g23270.1 upstream_gene_variant ; 1057.0bp to feature; MODIFIER silent_mutation Average:53.072; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0413281650 A -> G LOC_Os04g23270-LOC_Os04g23280 intergenic_region ; MODIFIER silent_mutation Average:53.072; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413281650 NA 4.26E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 1.80E-09 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 2.61E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 5.85E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 3.46E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 8.84E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 5.00E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 1.13E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 5.52E-06 5.54E-06 mr1313_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 1.74E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 7.94E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 6.86E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 9.61E-07 mr1472_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 5.84E-06 5.87E-06 mr1473_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 5.21E-06 5.21E-06 mr1473_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 2.33E-06 mr1483_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 1.15E-11 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 4.86E-06 4.87E-06 mr1630_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 2.62E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413281650 NA 6.64E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251