\
| Variant ID: vg0413281650 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13281650 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.29, others allele: 0.00, population size: 78. )
GACTAAAGATCAAATATGCCCGTTACCCTTTTGAACCGGGACTAAAGATCATCTTTAGCCCCGGTTTTTATTGCATCCGGGACTATTGTGGAAATCGGCC[A/G]
ACCGACGAAAGATGGTTTCTCCACCAGTGTGTAGGCGATGCATGGAAACAAACCCTCATACTCATTGCTTGCAGGCACACGAACTGTCTATGCTCACGGG
CCCGTGAGCATAGACAGTTCGTGTGCCTGCAAGCAATGAGTATGAGGGTTTGTTTCCATGCATCGCCTACACACTGGTGGAGAAACCATCTTTCGTCGGT[T/C]
GGCCGATTTCCACAATAGTCCCGGATGCAATAAAAACCGGGGCTAAAGATGATCTTTAGTCCCGGTTCAAAAGGGTAACGGGCATATTTGATCTTTAGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.00% | 17.50% | 1.31% | 42.26% | NA |
| All Indica | 2759 | 19.50% | 8.00% | 1.85% | 70.68% | NA |
| All Japonica | 1512 | 63.60% | 35.40% | 0.40% | 0.60% | NA |
| Aus | 269 | 77.30% | 18.20% | 0.00% | 4.46% | NA |
| Indica I | 595 | 35.80% | 0.00% | 6.39% | 57.82% | NA |
| Indica II | 465 | 6.00% | 24.70% | 0.22% | 69.03% | NA |
| Indica III | 913 | 17.30% | 4.30% | 0.22% | 78.20% | NA |
| Indica Intermediate | 786 | 17.70% | 8.40% | 1.27% | 72.65% | NA |
| Temperate Japonica | 767 | 96.60% | 2.70% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 14.90% | 84.30% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 60.20% | 37.30% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 93.80% | 4.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 17.80% | 3.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413281650 | A -> DEL | N | N | silent_mutation | Average:53.072; most accessible tissue: Zhenshan97 root, score: 72.671 | N | N | N | N |
| vg0413281650 | A -> G | LOC_Os04g23270.1 | upstream_gene_variant ; 1057.0bp to feature; MODIFIER | silent_mutation | Average:53.072; most accessible tissue: Zhenshan97 root, score: 72.671 | N | N | N | N |
| vg0413281650 | A -> G | LOC_Os04g23270-LOC_Os04g23280 | intergenic_region ; MODIFIER | silent_mutation | Average:53.072; most accessible tissue: Zhenshan97 root, score: 72.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413281650 | NA | 4.26E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 1.80E-09 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 2.61E-09 | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 5.85E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 3.46E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 8.84E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 5.00E-07 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 1.13E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | 5.52E-06 | 5.54E-06 | mr1313_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 1.74E-09 | mr1364_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 7.94E-07 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 6.86E-06 | mr1470_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 9.61E-07 | mr1472_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | 5.84E-06 | 5.87E-06 | mr1473_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | 5.21E-06 | 5.21E-06 | mr1473_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 2.33E-06 | mr1483_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 1.15E-11 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | 4.86E-06 | 4.87E-06 | mr1630_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 2.62E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413281650 | NA | 6.64E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |