\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413262397:

Variant ID: vg0413262397 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13262397
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTTTTTTGGGCAACCCCCTTTCACGGTGACGATTGACCTTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGTAGCGATCACAAGGAAGGAA[C/T]
AATAGTGAGGAGAAAGTACGTGCGGTCAACCGTCACCGCCGATGTATTGCCGTAATTGTTGTGTACACGATTTATTGAATATCGATATGAATCAATTGTT

Reverse complement sequence

AACAATTGATTCATATCGATATTCAATAAATCGTGTACACAACAATTACGGCAATACATCGGCGGTGACGGTTGACCGCACGTACTTTCTCCTCACTATT[G/A]
TTCCTTCCTTGTGATCGCTACGTGAGTAAGGGGTGTCTTCATTTGATAGGAGGATGCTAAGGTCAATCGTCACCGTGAAAGGGGGTTGCCCAAAAAACTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 21.90% 0.06% 0.00% NA
All Indica  2759 90.10% 9.90% 0.00% 0.00% NA
All Japonica  1512 65.30% 34.50% 0.20% 0.00% NA
Aus  269 22.70% 77.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 82.60% 17.40% 0.00% 0.00% NA
Indica Intermediate  786 88.40% 11.60% 0.00% 0.00% NA
Temperate Japonica  767 89.20% 10.60% 0.26% 0.00% NA
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 24.90% 0.41% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413262397 C -> T LOC_Os04g23240.1 missense_variant ; p.Thr818Ile; MODERATE nonsynonymous_codon ; T818I Average:15.596; most accessible tissue: Minghui63 panicle, score: 29.741 probably damaging 2.188 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413262397 NA 5.42E-09 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 4.61E-06 5.37E-08 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 7.84E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 6.41E-08 mr1047 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 1.48E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 1.34E-08 1.34E-08 mr1189 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 8.88E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 2.53E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 8.52E-06 1.97E-07 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 8.01E-08 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 1.48E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 9.79E-07 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 6.04E-06 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 9.01E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 1.12E-06 1.12E-06 mr1815 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 1.65E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 5.68E-07 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 8.43E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413262397 NA 3.37E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251