Search for Variation information by Variation ID:
Detailed information for vg0413260469:
| Variant ID: vg0413260469 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13260469 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.24, others allele: 0.00, population size: 218. )
Flanking Sequence (100 bp) in Reference Genome:
ACTGTTATGGAAGAAGGAAGGTGTTCCCGTGTGGGACGAGGACAAACAGGAGGAGTTTAACCTACGAGCACTGCTGTTCGTAACCATCAACGATTGGCCT[A/G]
CACTTAGCAACCTATCCGGGCAGTCCAATAAGGGGTATAAGGCTTGCACTCACTGTATGGATGAAACAGAAAGTACGTATCTTAAGCACTATAGGAAGGT
Reverse complement sequence
ACCTTCCTATAGTGCTTAAGATACGTACTTTCTGTTTCATCCATACAGTGAGTGCAAGCCTTATACCCCTTATTGGACTGCCCGGATAGGTTGCTAAGTG[T/C]
AGGCCAATCGTTGATGGTTACGAACAGCAGTGCTCGTAGGTTAAACTCCTCCTGTTTGTCCTCGTCCCACACGGGAACACCTTCCTTCTTCCATAACAGT
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 35.60% | 8.51% | 0.72% | NA |
| All Indica | 2759 | 63.20% | 21.50% | 14.10% | 1.20% | NA |
| All Japonica | 1512 | 35.40% | 64.10% | 0.40% | 0.07% | NA |
| Aus | 269 | 98.50% | 0.00% | 1.49% | 0.00% | NA |
| Indica I | 595 | 53.30% | 42.00% | 4.03% | 0.67% | NA |
| Indica II | 465 | 68.80% | 26.70% | 4.30% | 0.22% | NA |
| Indica III | 913 | 63.40% | 7.90% | 26.29% | 2.41% | NA |
| Indica Intermediate | 786 | 67.30% | 18.60% | 13.36% | 0.76% | NA |
| Temperate Japonica | 767 | 10.80% | 88.50% | 0.52% | 0.13% | NA |
| Tropical Japonica | 504 | 76.60% | 23.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.80% | 71.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 48.90% | 3.33% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413260469 | A -> DEL | LOC_Os04g23240.1 | N | frameshift_variant | Average:26.188; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| vg0413260469 | A -> G | LOC_Os04g23240.1 | missense_variant ; p.Thr444Ala; MODERATE | nonsynonymous_codon ; T444A | Average:26.188; most accessible tissue: Minghui63 flag leaf, score: 44.406 | benign  |
-0.891 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413260469 | 2.88E-06 | 4.79E-08 | mr1029 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | NA | 1.25E-07 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | 2.77E-08 | 2.77E-08 | mr1189 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | NA | 9.14E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | NA | 1.76E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | 2.68E-06 | 8.37E-08 | mr1625 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | NA | 6.01E-07 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | NA | 1.31E-06 | mr1725 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | NA | 1.05E-06 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | 6.91E-06 | 6.90E-06 | mr1815 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260469 | NA | 9.24E-07 | mr1990 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |