\
| Variant ID: vg0413260405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13260405 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGGCCCCAAGCAACCTGGTAACGACATCGATGTATACATAAGACCACTAGTCGAAGATCTTAAACTGTTATGGAAGAAGGAAGGTGTTCCCGTGTGGGA[C/T]
GAGGACAAACAGGAGGAGTTTAACCTACGAGCACTGCTGTTCGTAACCATCAACGATTGGCCTACACTTAGCAACCTATCCGGGCAGTCCAATAAGGGGT
ACCCCTTATTGGACTGCCCGGATAGGTTGCTAAGTGTAGGCCAATCGTTGATGGTTACGAACAGCAGTGCTCGTAGGTTAAACTCCTCCTGTTTGTCCTC[G/A]
TCCCACACGGGAACACCTTCCTTCTTCCATAACAGTTTAAGATCTTCGACTAGTGGTCTTATGTATACATCGATGTCGTTACCAGGTTGCTTGGGGCCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.90% | 12.20% | 1.23% | 3.68% | NA |
| All Indica | 2759 | 89.30% | 2.50% | 1.92% | 6.23% | NA |
| All Japonica | 1512 | 67.40% | 32.30% | 0.20% | 0.07% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.37% | 0.37% | NA |
| Indica I | 595 | 95.30% | 0.00% | 1.18% | 3.53% | NA |
| Indica II | 465 | 96.30% | 1.50% | 0.86% | 1.29% | NA |
| Indica III | 913 | 80.90% | 4.10% | 3.29% | 11.72% | NA |
| Indica Intermediate | 786 | 90.30% | 3.30% | 1.53% | 4.83% | NA |
| Temperate Japonica | 767 | 90.50% | 9.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 26.20% | 73.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413260405 | C -> DEL | LOC_Os04g23240.1 | N | frameshift_variant | Average:25.475; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| vg0413260405 | C -> T | LOC_Os04g23240.1 | synonymous_variant ; p.Asp422Asp; LOW | synonymous_codon | Average:25.475; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413260405 | NA | 9.34E-07 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 5.41E-10 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 7.19E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 4.08E-09 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | 2.41E-06 | 3.07E-08 | mr1189 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | 4.43E-06 | NA | mr1471 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 2.17E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 6.14E-08 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 3.21E-10 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 2.30E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 2.74E-07 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 8.99E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 2.57E-08 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413260405 | NA | 1.54E-09 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |