\
| Variant ID: vg0413177353 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13177353 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 327. )
AACCAAAACTGGGTGATCATAATGTCCTATGTCCAAAACAGCACACTCTCCTGACAAGGTAGAGTATTCTGTCTCGCCTGTCCTCTCCTCCTCAAAATTG[A/G]
TTTAGGACATGAGGCTTCGAATGATCATTCGTTTCCTCTACATGTGTGTGCAGAACACAAGAAAATCTCACGACAAAATGAGGACTTTTCATTCATTATA
TATAATGAATGAAAAGTCCTCATTTTGTCGTGAGATTTTCTTGTGTTCTGCACACACATGTAGAGGAAACGAATGATCATTCGAAGCCTCATGTCCTAAA[T/C]
CAATTTTGAGGAGGAGAGGACAGGCGAGACAGAATACTCTACCTTGTCAGGAGAGTGTGCTGTTTTGGACATAGGACATTATGATCACCCAGTTTTGGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.30% | 0.50% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 1.60% | 0.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.00% | 3.10% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413177353 | A -> G | LOC_Os04g23170.1 | upstream_gene_variant ; 2690.0bp to feature; MODIFIER | silent_mutation | Average:58.604; most accessible tissue: Callus, score: 72.256 | N | N | N | N |
| vg0413177353 | A -> G | LOC_Os04g23180.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.604; most accessible tissue: Callus, score: 72.256 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413177353 | NA | 9.27E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413177353 | NA | 6.06E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413177353 | NA | 1.10E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413177353 | 2.26E-06 | 2.26E-06 | mr1674 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413177353 | NA | 4.03E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413177353 | NA | 7.72E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413177353 | NA | 6.62E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |