RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0413157681:

Variant ID: vg0413157681 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13157681
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTCTTATGCTCGTTTATATAGACTGTTCGAGACTTCTAGTGTTGTCAATAGCAGTACAAAATATGGGACCGTAGAGCTTGTTGAAAGAAAATGAGCCA[G/C]
AATTGCTGAACATTTGGTTCATTTTAAAAACTATCAATGCAAATGGACACAACATGGAGATTACTATGAAAGCAGGCGATTTGGTATGGAATGAAATATT

Reverse complement sequence

AATATTTCATTCCATACCAAATCGCCTGCTTTCATAGTAATCTCCATGTTGTGTCCATTTGCATTGATAGTTTTTAAAATGAACCAAATGTTCAGCAATT[C/G]
TGGCTCATTTTCTTTCAACAAGCTCTACGGTCCCATATTTTGTACTGCTATTGACAACACTAGAAGTCTCGAACAGTCTATATAAACGAGCATAAGAGAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	4.60%	1.84%	0.00%	NA
All Indica	2759	99.30%	0.10%	0.58%	0.00%	NA
All Japonica	1512	81.50%	14.00%	4.50%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.80%	0.20%	2.02%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.10%	0.51%	0.00%	NA
Temperate Japonica	767	94.10%	2.10%	3.78%	0.00%	NA
Tropical Japonica	504	65.10%	29.60%	5.36%	0.00%	NA
Japonica Intermediate	241	75.90%	19.10%	4.98%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	3.30%	3.33%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413157681	G -> C	LOC_Os04g23140.1	downstream_gene_variant ; 2166.0bp to feature; MODIFIER	silent_mutation	Average:37.575; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg0413157681	G -> C	LOC_Os04g23140.2	downstream_gene_variant ; 2166.0bp to feature; MODIFIER	silent_mutation	Average:37.575; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N
vg0413157681	G -> C	LOC_Os04g23140-LOC_Os04g23170	intergenic_region ; MODIFIER	silent_mutation	Average:37.575; most accessible tissue: Zhenshan97 young leaf, score: 67.334	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413157681	NA	1.36E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681	2.27E-06	2.01E-10	mr1668	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681	NA	6.85E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681	NA	5.27E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681	NA	2.47E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681	NA	2.55E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0413157681:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact