\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413157681:

Variant ID: vg0413157681 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13157681
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTCTTATGCTCGTTTATATAGACTGTTCGAGACTTCTAGTGTTGTCAATAGCAGTACAAAATATGGGACCGTAGAGCTTGTTGAAAGAAAATGAGCCA[G/C]
AATTGCTGAACATTTGGTTCATTTTAAAAACTATCAATGCAAATGGACACAACATGGAGATTACTATGAAAGCAGGCGATTTGGTATGGAATGAAATATT

Reverse complement sequence

AATATTTCATTCCATACCAAATCGCCTGCTTTCATAGTAATCTCCATGTTGTGTCCATTTGCATTGATAGTTTTTAAAATGAACCAAATGTTCAGCAATT[C/G]
TGGCTCATTTTCTTTCAACAAGCTCTACGGTCCCATATTTTGTACTGCTATTGACAACACTAGAAGTCTCGAACAGTCTATATAAACGAGCATAAGAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 4.60% 1.84% 0.00% NA
All Indica  2759 99.30% 0.10% 0.58% 0.00% NA
All Japonica  1512 81.50% 14.00% 4.50% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.20% 2.02% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.10% 0.51% 0.00% NA
Temperate Japonica  767 94.10% 2.10% 3.78% 0.00% NA
Tropical Japonica  504 65.10% 29.60% 5.36% 0.00% NA
Japonica Intermediate  241 75.90% 19.10% 4.98% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413157681 G -> C LOC_Os04g23140.1 downstream_gene_variant ; 2166.0bp to feature; MODIFIER silent_mutation Average:37.575; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg0413157681 G -> C LOC_Os04g23140.2 downstream_gene_variant ; 2166.0bp to feature; MODIFIER silent_mutation Average:37.575; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg0413157681 G -> C LOC_Os04g23140-LOC_Os04g23170 intergenic_region ; MODIFIER silent_mutation Average:37.575; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413157681 NA 1.36E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681 2.27E-06 2.01E-10 mr1668 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681 NA 6.85E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681 NA 5.27E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681 NA 2.47E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413157681 NA 2.55E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251