\
| Variant ID: vg0413157681 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13157681 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 268. )
TTCTCTTATGCTCGTTTATATAGACTGTTCGAGACTTCTAGTGTTGTCAATAGCAGTACAAAATATGGGACCGTAGAGCTTGTTGAAAGAAAATGAGCCA[G/C]
AATTGCTGAACATTTGGTTCATTTTAAAAACTATCAATGCAAATGGACACAACATGGAGATTACTATGAAAGCAGGCGATTTGGTATGGAATGAAATATT
AATATTTCATTCCATACCAAATCGCCTGCTTTCATAGTAATCTCCATGTTGTGTCCATTTGCATTGATAGTTTTTAAAATGAACCAAATGTTCAGCAATT[C/G]
TGGCTCATTTTCTTTCAACAAGCTCTACGGTCCCATATTTTGTACTGCTATTGACAACACTAGAAGTCTCGAACAGTCTATATAAACGAGCATAAGAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 4.60% | 1.84% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.10% | 0.58% | 0.00% | NA |
| All Japonica | 1512 | 81.50% | 14.00% | 4.50% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 0.20% | 2.02% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 94.10% | 2.10% | 3.78% | 0.00% | NA |
| Tropical Japonica | 504 | 65.10% | 29.60% | 5.36% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 19.10% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413157681 | G -> C | LOC_Os04g23140.1 | downstream_gene_variant ; 2166.0bp to feature; MODIFIER | silent_mutation | Average:37.575; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg0413157681 | G -> C | LOC_Os04g23140.2 | downstream_gene_variant ; 2166.0bp to feature; MODIFIER | silent_mutation | Average:37.575; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg0413157681 | G -> C | LOC_Os04g23140-LOC_Os04g23170 | intergenic_region ; MODIFIER | silent_mutation | Average:37.575; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413157681 | NA | 1.36E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413157681 | 2.27E-06 | 2.01E-10 | mr1668 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413157681 | NA | 6.85E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413157681 | NA | 5.27E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413157681 | NA | 2.47E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413157681 | NA | 2.55E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |