Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0413126535:

Variant ID: vg0413126535 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13126535
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAGAGGTTTCGCCATACGCCATACCCTTCGCCATAATACCAATGAGGTACGGCATCAAGGGTTGCGGGCGAACAGGTTTCGCCCACCCACGCCTTTCGC[C/T]
ATAGGACCAATGAGGTACGGCATCAAGGGATGCGGGCGAAGAGGTTTCGTCCACCCTCGCCCTTCGCCATAGCGCCAATAAGGCACGGCATCAAGGGCTG

Reverse complement sequence

CAGCCCTTGATGCCGTGCCTTATTGGCGCTATGGCGAAGGGCGAGGGTGGACGAAACCTCTTCGCCCGCATCCCTTGATGCCGTACCTCATTGGTCCTAT[G/A]
GCGAAAGGCGTGGGTGGGCGAAACCTGTTCGCCCGCAACCCTTGATGCCGTACCTCATTGGTATTATGGCGAAGGGTATGGCGTATGGCGAAACCTCTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	0.20%	0.93%	20.74%	NA
All Indica	2759	64.60%	0.00%	0.76%	34.61%	NA
All Japonica	1512	97.40%	0.70%	1.52%	0.33%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	87.40%	0.00%	0.17%	12.44%	NA
Indica II	465	57.00%	0.00%	1.29%	41.72%	NA
Indica III	913	60.00%	0.00%	0.77%	39.21%	NA
Indica Intermediate	786	57.30%	0.00%	0.89%	41.86%	NA
Temperate Japonica	767	96.10%	1.40%	2.48%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	96.70%	0.00%	1.66%	1.66%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	0.00%	0.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413126535	C -> DEL	N	N	silent_mutation	Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0413126535	C -> T	LOC_Os04g23090.1	downstream_gene_variant ; 1930.0bp to feature; MODIFIER	silent_mutation	Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0413126535	C -> T	LOC_Os04g23100.1	downstream_gene_variant ; 3550.0bp to feature; MODIFIER	silent_mutation	Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0413126535	C -> T	LOC_Os04g23090-LOC_Os04g23100	intergenic_region ; MODIFIER	silent_mutation	Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413126535	NA	8.60E-07	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535	NA	9.26E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535	5.89E-06	6.72E-08	mr1358	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535	NA	6.39E-06	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535	NA	5.88E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535	4.24E-06	8.01E-06	mr1654	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535	7.01E-06	7.01E-06	mr1996	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251