\
| Variant ID: vg0413126535 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13126535 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAGAGGTTTCGCCATACGCCATACCCTTCGCCATAATACCAATGAGGTACGGCATCAAGGGTTGCGGGCGAACAGGTTTCGCCCACCCACGCCTTTCGC[C/T]
ATAGGACCAATGAGGTACGGCATCAAGGGATGCGGGCGAAGAGGTTTCGTCCACCCTCGCCCTTCGCCATAGCGCCAATAAGGCACGGCATCAAGGGCTG
CAGCCCTTGATGCCGTGCCTTATTGGCGCTATGGCGAAGGGCGAGGGTGGACGAAACCTCTTCGCCCGCATCCCTTGATGCCGTACCTCATTGGTCCTAT[G/A]
GCGAAAGGCGTGGGTGGGCGAAACCTGTTCGCCCGCAACCCTTGATGCCGTACCTCATTGGTATTATGGCGAAGGGTATGGCGTATGGCGAAACCTCTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 0.20% | 0.93% | 20.74% | NA |
| All Indica | 2759 | 64.60% | 0.00% | 0.76% | 34.61% | NA |
| All Japonica | 1512 | 97.40% | 0.70% | 1.52% | 0.33% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 87.40% | 0.00% | 0.17% | 12.44% | NA |
| Indica II | 465 | 57.00% | 0.00% | 1.29% | 41.72% | NA |
| Indica III | 913 | 60.00% | 0.00% | 0.77% | 39.21% | NA |
| Indica Intermediate | 786 | 57.30% | 0.00% | 0.89% | 41.86% | NA |
| Temperate Japonica | 767 | 96.10% | 1.40% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 1.66% | 1.66% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 0.00% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413126535 | C -> DEL | N | N | silent_mutation | Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0413126535 | C -> T | LOC_Os04g23090.1 | downstream_gene_variant ; 1930.0bp to feature; MODIFIER | silent_mutation | Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0413126535 | C -> T | LOC_Os04g23100.1 | downstream_gene_variant ; 3550.0bp to feature; MODIFIER | silent_mutation | Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0413126535 | C -> T | LOC_Os04g23090-LOC_Os04g23100 | intergenic_region ; MODIFIER | silent_mutation | Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413126535 | NA | 8.60E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413126535 | NA | 9.26E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413126535 | 5.89E-06 | 6.72E-08 | mr1358 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413126535 | NA | 6.39E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413126535 | NA | 5.88E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413126535 | 4.24E-06 | 8.01E-06 | mr1654 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413126535 | 7.01E-06 | 7.01E-06 | mr1996 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |