\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413126535:

Variant ID: vg0413126535 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13126535
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGAGGTTTCGCCATACGCCATACCCTTCGCCATAATACCAATGAGGTACGGCATCAAGGGTTGCGGGCGAACAGGTTTCGCCCACCCACGCCTTTCGC[C/T]
ATAGGACCAATGAGGTACGGCATCAAGGGATGCGGGCGAAGAGGTTTCGTCCACCCTCGCCCTTCGCCATAGCGCCAATAAGGCACGGCATCAAGGGCTG

Reverse complement sequence

CAGCCCTTGATGCCGTGCCTTATTGGCGCTATGGCGAAGGGCGAGGGTGGACGAAACCTCTTCGCCCGCATCCCTTGATGCCGTACCTCATTGGTCCTAT[G/A]
GCGAAAGGCGTGGGTGGGCGAAACCTGTTCGCCCGCAACCCTTGATGCCGTACCTCATTGGTATTATGGCGAAGGGTATGGCGTATGGCGAAACCTCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 0.20% 0.93% 20.74% NA
All Indica  2759 64.60% 0.00% 0.76% 34.61% NA
All Japonica  1512 97.40% 0.70% 1.52% 0.33% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 87.40% 0.00% 0.17% 12.44% NA
Indica II  465 57.00% 0.00% 1.29% 41.72% NA
Indica III  913 60.00% 0.00% 0.77% 39.21% NA
Indica Intermediate  786 57.30% 0.00% 0.89% 41.86% NA
Temperate Japonica  767 96.10% 1.40% 2.48% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 96.70% 0.00% 1.66% 1.66% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 0.00% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413126535 C -> DEL N N silent_mutation Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0413126535 C -> T LOC_Os04g23090.1 downstream_gene_variant ; 1930.0bp to feature; MODIFIER silent_mutation Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0413126535 C -> T LOC_Os04g23100.1 downstream_gene_variant ; 3550.0bp to feature; MODIFIER silent_mutation Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0413126535 C -> T LOC_Os04g23090-LOC_Os04g23100 intergenic_region ; MODIFIER silent_mutation Average:24.335; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413126535 NA 8.60E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535 NA 9.26E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535 5.89E-06 6.72E-08 mr1358 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535 NA 6.39E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535 NA 5.88E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535 4.24E-06 8.01E-06 mr1654 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413126535 7.01E-06 7.01E-06 mr1996 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251