\
| Variant ID: vg0413095791 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13095791 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 103. )
ATATTGAAACGACAAACCGGTTGATGTTTGGAGTCATCGAATTCGTTGAGATTAATCTCAACGCCTATTTTAGAATTGATTCCATCGCACTCGTCGACGG[A/G]
AAACTCGATGCATCCCCAACCTAGCACGCCAACTGTCGAAACATGAATTCGGCAATAATAAAAAAGGGTAGCGCACTAGACCTAAAATTGGATGGATGCG
CGCATCCATCCAATTTTAGGTCTAGTGCGCTACCCTTTTTTATTATTGCCGAATTCATGTTTCGACAGTTGGCGTGCTAGGTTGGGGATGCATCGAGTTT[T/C]
CCGTCGACGAGTGCGATGGAATCAATTCTAAAATAGGCGTTGAGATTAATCTCAACGAATTCGATGACTCCAAACATCAACCGGTTTGTCGTTTCAATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 39.40% | 1.33% | 16.91% | NA |
| All Indica | 2759 | 68.20% | 10.50% | 1.49% | 19.75% | NA |
| All Japonica | 1512 | 4.60% | 95.00% | 0.07% | 0.33% | NA |
| Aus | 269 | 5.90% | 5.90% | 3.72% | 84.39% | NA |
| Indica I | 595 | 61.50% | 25.90% | 1.01% | 11.60% | NA |
| Indica II | 465 | 72.00% | 11.40% | 1.51% | 15.05% | NA |
| Indica III | 913 | 67.80% | 2.70% | 0.88% | 28.59% | NA |
| Indica Intermediate | 786 | 71.50% | 7.50% | 2.54% | 18.45% | NA |
| Temperate Japonica | 767 | 2.00% | 97.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.00% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 19.90% | 79.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 5.20% | 75.00% | 9.38% | 10.42% | NA |
| Intermediate | 90 | 32.20% | 52.20% | 2.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413095791 | A -> DEL | N | N | silent_mutation | Average:39.608; most accessible tissue: Callus, score: 91.869 | N | N | N | N |
| vg0413095791 | A -> G | LOC_Os04g23060.1 | upstream_gene_variant ; 442.0bp to feature; MODIFIER | silent_mutation | Average:39.608; most accessible tissue: Callus, score: 91.869 | N | N | N | N |
| vg0413095791 | A -> G | LOC_Os04g23050.1 | downstream_gene_variant ; 3759.0bp to feature; MODIFIER | silent_mutation | Average:39.608; most accessible tissue: Callus, score: 91.869 | N | N | N | N |
| vg0413095791 | A -> G | LOC_Os04g23050-LOC_Os04g23060 | intergenic_region ; MODIFIER | silent_mutation | Average:39.608; most accessible tissue: Callus, score: 91.869 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413095791 | NA | 4.35E-06 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 8.72E-07 | mr1245 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 1.34E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 6.67E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 1.15E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 1.15E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 4.25E-06 | mr1811 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 5.31E-06 | mr1812 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 1.43E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 5.02E-06 | mr1992 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413095791 | NA | 8.41E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |