\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413095791:

Variant ID: vg0413095791 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13095791
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTGAAACGACAAACCGGTTGATGTTTGGAGTCATCGAATTCGTTGAGATTAATCTCAACGCCTATTTTAGAATTGATTCCATCGCACTCGTCGACGG[A/G]
AAACTCGATGCATCCCCAACCTAGCACGCCAACTGTCGAAACATGAATTCGGCAATAATAAAAAAGGGTAGCGCACTAGACCTAAAATTGGATGGATGCG

Reverse complement sequence

CGCATCCATCCAATTTTAGGTCTAGTGCGCTACCCTTTTTTATTATTGCCGAATTCATGTTTCGACAGTTGGCGTGCTAGGTTGGGGATGCATCGAGTTT[T/C]
CCGTCGACGAGTGCGATGGAATCAATTCTAAAATAGGCGTTGAGATTAATCTCAACGAATTCGATGACTCCAAACATCAACCGGTTTGTCGTTTCAATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 39.40% 1.33% 16.91% NA
All Indica  2759 68.20% 10.50% 1.49% 19.75% NA
All Japonica  1512 4.60% 95.00% 0.07% 0.33% NA
Aus  269 5.90% 5.90% 3.72% 84.39% NA
Indica I  595 61.50% 25.90% 1.01% 11.60% NA
Indica II  465 72.00% 11.40% 1.51% 15.05% NA
Indica III  913 67.80% 2.70% 0.88% 28.59% NA
Indica Intermediate  786 71.50% 7.50% 2.54% 18.45% NA
Temperate Japonica  767 2.00% 97.90% 0.13% 0.00% NA
Tropical Japonica  504 1.20% 98.00% 0.00% 0.79% NA
Japonica Intermediate  241 19.90% 79.70% 0.00% 0.41% NA
VI/Aromatic  96 5.20% 75.00% 9.38% 10.42% NA
Intermediate  90 32.20% 52.20% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413095791 A -> DEL N N silent_mutation Average:39.608; most accessible tissue: Callus, score: 91.869 N N N N
vg0413095791 A -> G LOC_Os04g23060.1 upstream_gene_variant ; 442.0bp to feature; MODIFIER silent_mutation Average:39.608; most accessible tissue: Callus, score: 91.869 N N N N
vg0413095791 A -> G LOC_Os04g23050.1 downstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:39.608; most accessible tissue: Callus, score: 91.869 N N N N
vg0413095791 A -> G LOC_Os04g23050-LOC_Os04g23060 intergenic_region ; MODIFIER silent_mutation Average:39.608; most accessible tissue: Callus, score: 91.869 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413095791 NA 4.35E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 8.72E-07 mr1245 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 1.34E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 6.67E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 1.15E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 1.15E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 4.25E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 5.31E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 1.43E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 5.02E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413095791 NA 8.41E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251