\
| Variant ID: vg0412992801 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12992801 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAAAAAATCATGAGCTGCAATTAAGAGTCCGATCATCTTAAGTTAGTATGTGAGTTTTTTTTAAGAAATATATTATACGACTCCTTCCGTATTTCCAAAA[G/A]
CGAACGGGCTTAAAACCCGACTCAAATACGGATCTATATTTTCAAAATAAAATGAACTTAAAAACCAACTCTATATATAGATGACATACCAAAGCAAAAA
TTTTTGCTTTGGTATGTCATCTATATATAGAGTTGGTTTTTAAGTTCATTTTATTTTGAAAATATAGATCCGTATTTGAGTCGGGTTTTAAGCCCGTTCG[C/T]
TTTTGGAAATACGGAAGGAGTCGTATAATATATTTCTTAAAAAAAACTCACATACTAACTTAAGATGATCGGACTCTTAATTGCAGCTCATGATTTTTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 21.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 74.20% | 25.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 50.20% | 49.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412992801 | G -> A | LOC_Os04g22900.2 | 3_prime_UTR_variant ; 216.0bp to feature; MODIFIER | silent_mutation | Average:38.729; most accessible tissue: Callus, score: 60.091 | N | N | N | N |
| vg0412992801 | G -> A | LOC_Os04g22910.1 | downstream_gene_variant ; 4877.0bp to feature; MODIFIER | silent_mutation | Average:38.729; most accessible tissue: Callus, score: 60.091 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412992801 | NA | 4.15E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412992801 | NA | 5.98E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412992801 | NA | 8.39E-07 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412992801 | 8.99E-06 | NA | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412992801 | 2.38E-07 | 5.06E-11 | mr1705_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412992801 | NA | 2.03E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412992801 | NA | 2.35E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |