\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412918734:

Variant ID: vg0412918734 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12918734
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTCCTTAGCCACCCACAACTTCCATGAACTCTTTCATGCGCTGCTCTTGTTCCTCAACCTTCCTTGTCAGCTCCGCCACGGCCTCGCCATGCGCCGC[A/G]
TCCCGTGCCCCCACTGCAGCGAAGACGGCGTGCATATGTTGTCGCACACCCCTTCCTCTCCTGCAGCGCGGGCTCTATATGCGGCGACCACCGGCACCGC

Reverse complement sequence

GCGGTGCCGGTGGTCGCCGCATATAGAGCCCGCGCTGCAGGAGAGGAAGGGGTGTGCGACAACATATGCACGCCGTCTTCGCTGCAGTGGGGGCACGGGA[T/C]
GCGGCGCATGGCGAGGCCGTGGCGGAGCTGACAAGGAAGGTTGAGGAACAAGAGCAGCGCATGAAAGAGTTCATGGAAGTTGTGGGTGGCTAAGGAGCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 46.30% 1.06% 0.72% NA
All Indica  2759 77.70% 19.40% 1.67% 1.23% NA
All Japonica  1512 1.70% 98.10% 0.13% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 64.70% 34.10% 1.01% 0.17% NA
Indica II  465 57.20% 33.10% 4.52% 5.16% NA
Indica III  913 97.50% 2.10% 0.33% 0.11% NA
Indica Intermediate  786 76.70% 20.20% 2.04% 1.02% NA
Temperate Japonica  767 1.60% 98.20% 0.26% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 33.30% 64.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412918734 A -> DEL LOC_Os04g22800.1 N frameshift_variant Average:63.557; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0412918734 A -> G LOC_Os04g22800.1 missense_variant ; p.Ile265Val; MODERATE nonsynonymous_codon ; I265V Average:63.557; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 unknown unknown TOLERATED 0.62

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412918734 NA 3.58E-28 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 9.39E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 1.03E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 7.68E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 9.30E-16 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 1.10E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 2.69E-22 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 9.54E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 8.19E-28 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 8.24E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 6.72E-10 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 5.14E-08 NA mr1549 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 8.84E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 9.95E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 2.93E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 1.28E-11 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 2.83E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 5.98E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 2.57E-25 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 2.89E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 5.60E-51 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412918734 NA 4.31E-32 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251