\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412914977:

Variant ID: vg0412914977 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12914977
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGCTCAGGAGGAATGGAGGTCACAACCTACAGAACTAGGGAGATTTACCATGGCAATGATCCATGATTGACACCGTTGACTGCAGCGAGTCGCAGCTC[T/C]
AGTGAACTGCTATAGCAGAGGCATCAATTCCGATGAAATATAGCCCCTCCTTTGTTTATGGTACGCTATTTCTTCCAGAGGCTTCTCATTCCTATCACTA

Reverse complement sequence

TAGTGATAGGAATGAGAAGCCTCTGGAAGAAATAGCGTACCATAAACAAAGGAGGGGCTATATTTCATCGGAATTGATGCCTCTGCTATAGCAGTTCACT[A/G]
GAGCTGCGACTCGCTGCAGTCAACGGTGTCAATCATGGATCATTGCCATGGTAAATCTCCCTAGTTCTGTAGGTTGTGACCTCCATTCCTCCTGAGCAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 45.70% 0.15% 0.00% NA
All Indica  2759 81.30% 18.40% 0.25% 0.00% NA
All Japonica  1512 1.80% 98.20% 0.00% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 68.60% 30.90% 0.50% 0.00% NA
Indica II  465 63.40% 36.30% 0.22% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 81.70% 17.90% 0.38% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 35.60% 64.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412914977 T -> C LOC_Os04g22800.1 upstream_gene_variant ; 1487.0bp to feature; MODIFIER silent_mutation Average:47.883; most accessible tissue: Callus, score: 87.446 N N N N
vg0412914977 T -> C LOC_Os04g22790-LOC_Os04g22800 intergenic_region ; MODIFIER silent_mutation Average:47.883; most accessible tissue: Callus, score: 87.446 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412914977 NA 5.08E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 2.49E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 2.86E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 3.16E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 1.38E-20 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 1.24E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 9.40E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 1.74E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 1.34E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 1.65E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 4.58E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 2.10E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 8.13E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 2.18E-08 9.18E-06 mr1719 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 7.82E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 5.04E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 1.63E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412914977 NA 1.56E-24 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251