\
| Variant ID: vg0412903510 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12903510 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGGGAGCTAGAGCTTTGCTTGAAGTATCTTCTTCTGCCTCATCAAGATAATCTTTGATATCAAAAGAGAAGAGATCGGCTAGAACCTGCAGGTATAAGTT[T/C]
AGAAAGTTTGAGAGCTAAGTCAATATAGTCGATCTAAATTCTTGCATCAAAGGAAAACTTACTGGGATAGCAGGAGCAGCCGATTGTTCTTCTTCCACAA
TTGTGGAAGAAGAACAATCGGCTGCTCCTGCTATCCCAGTAAGTTTTCCTTTGATGCAAGAATTTAGATCGACTATATTGACTTAGCTCTCAAACTTTCT[A/G]
AACTTATACCTGCAGGTTCTAGCCGATCTCTTCTCTTTTGATATCAAAGATTATCTTGATGAGGCAGAAGAAGATACTTCAAGCAAAGCTCTAGCTCCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.30% | 20.60% | 15.13% | 25.03% | NA |
| All Indica | 2759 | 36.70% | 3.80% | 23.12% | 36.32% | NA |
| All Japonica | 1512 | 48.20% | 49.50% | 1.06% | 1.26% | NA |
| Aus | 269 | 26.80% | 2.60% | 17.47% | 53.16% | NA |
| Indica I | 595 | 43.70% | 4.70% | 27.56% | 24.03% | NA |
| Indica II | 465 | 38.10% | 6.20% | 28.39% | 27.31% | NA |
| Indica III | 913 | 33.50% | 1.00% | 16.21% | 49.29% | NA |
| Indica Intermediate | 786 | 34.40% | 5.10% | 24.68% | 35.88% | NA |
| Temperate Japonica | 767 | 84.70% | 12.90% | 1.43% | 0.91% | NA |
| Tropical Japonica | 504 | 5.60% | 92.90% | 0.60% | 0.99% | NA |
| Japonica Intermediate | 241 | 21.20% | 75.10% | 0.83% | 2.90% | NA |
| VI/Aromatic | 96 | 8.30% | 85.40% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 36.70% | 33.30% | 14.44% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412903510 | T -> C | LOC_Os04g22770.1 | upstream_gene_variant ; 4622.0bp to feature; MODIFIER | silent_mutation | Average:8.048; most accessible tissue: Callus, score: 21.998 | N | N | N | N |
| vg0412903510 | T -> C | LOC_Os04g22780.1 | downstream_gene_variant ; 1307.0bp to feature; MODIFIER | silent_mutation | Average:8.048; most accessible tissue: Callus, score: 21.998 | N | N | N | N |
| vg0412903510 | T -> C | LOC_Os04g22790.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.048; most accessible tissue: Callus, score: 21.998 | N | N | N | N |
| vg0412903510 | T -> DEL | N | N | silent_mutation | Average:8.048; most accessible tissue: Callus, score: 21.998 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412903510 | NA | 3.83E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | NA | 1.54E-06 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | NA | 3.52E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | NA | 4.90E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | NA | 2.04E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | NA | 2.16E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | NA | 4.10E-09 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | 3.55E-06 | NA | mr1719 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | NA | 3.18E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | NA | 4.28E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412903510 | NA | 1.30E-07 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |