\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412903510:

Variant ID: vg0412903510 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12903510
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGAGCTAGAGCTTTGCTTGAAGTATCTTCTTCTGCCTCATCAAGATAATCTTTGATATCAAAAGAGAAGAGATCGGCTAGAACCTGCAGGTATAAGTT[T/C]
AGAAAGTTTGAGAGCTAAGTCAATATAGTCGATCTAAATTCTTGCATCAAAGGAAAACTTACTGGGATAGCAGGAGCAGCCGATTGTTCTTCTTCCACAA

Reverse complement sequence

TTGTGGAAGAAGAACAATCGGCTGCTCCTGCTATCCCAGTAAGTTTTCCTTTGATGCAAGAATTTAGATCGACTATATTGACTTAGCTCTCAAACTTTCT[A/G]
AACTTATACCTGCAGGTTCTAGCCGATCTCTTCTCTTTTGATATCAAAGATTATCTTGATGAGGCAGAAGAAGATACTTCAAGCAAAGCTCTAGCTCCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 20.60% 15.13% 25.03% NA
All Indica  2759 36.70% 3.80% 23.12% 36.32% NA
All Japonica  1512 48.20% 49.50% 1.06% 1.26% NA
Aus  269 26.80% 2.60% 17.47% 53.16% NA
Indica I  595 43.70% 4.70% 27.56% 24.03% NA
Indica II  465 38.10% 6.20% 28.39% 27.31% NA
Indica III  913 33.50% 1.00% 16.21% 49.29% NA
Indica Intermediate  786 34.40% 5.10% 24.68% 35.88% NA
Temperate Japonica  767 84.70% 12.90% 1.43% 0.91% NA
Tropical Japonica  504 5.60% 92.90% 0.60% 0.99% NA
Japonica Intermediate  241 21.20% 75.10% 0.83% 2.90% NA
VI/Aromatic  96 8.30% 85.40% 1.04% 5.21% NA
Intermediate  90 36.70% 33.30% 14.44% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412903510 T -> C LOC_Os04g22770.1 upstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:8.048; most accessible tissue: Callus, score: 21.998 N N N N
vg0412903510 T -> C LOC_Os04g22780.1 downstream_gene_variant ; 1307.0bp to feature; MODIFIER silent_mutation Average:8.048; most accessible tissue: Callus, score: 21.998 N N N N
vg0412903510 T -> C LOC_Os04g22790.1 intron_variant ; MODIFIER silent_mutation Average:8.048; most accessible tissue: Callus, score: 21.998 N N N N
vg0412903510 T -> DEL N N silent_mutation Average:8.048; most accessible tissue: Callus, score: 21.998 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412903510 NA 3.83E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 NA 1.54E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 NA 3.52E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 NA 4.90E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 NA 2.04E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 NA 2.16E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 NA 4.10E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 3.55E-06 NA mr1719 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 NA 3.18E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 NA 4.28E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412903510 NA 1.30E-07 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251