\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412882680:

Variant ID: vg0412882680 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12882680
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGAAGCGCCACAAGCTGGTCATTGTGGAAGAACTTGTGAGAATGATGACCTCTGGCGTTTCTAGGATGTGCTAATGTCGAATTGCAAGCATTTAGAGAT[T/C]
AGGAATCTAGGATCATGTTATCAGACCTATTATAGTTGCTAGATTAATCAGTTTGATCAACTTACCTTCTGAGACTATTTTATTTATGTGTTATTGTCTA

Reverse complement sequence

TAGACAATAACACATAAATAAAATAGTCTCAGAAGGTAAGTTGATCAAACTGATTAATCTAGCAACTATAATAGGTCTGATAACATGATCCTAGATTCCT[A/G]
ATCTCTAAATGCTTGCAATTCGACATTAGCACATCCTAGAAACGCCAGAGGTCATCATTCTCACAAGTTCTTCCACAATGACCAGCTTGTGGCGCTTCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 1.20% 28.33% 19.28% NA
All Indica  2759 28.20% 0.00% 40.38% 31.39% NA
All Japonica  1512 94.90% 3.60% 0.86% 0.60% NA
Aus  269 20.80% 0.00% 68.40% 10.78% NA
Indica I  595 49.60% 0.00% 28.57% 21.85% NA
Indica II  465 43.90% 0.00% 24.09% 32.04% NA
Indica III  913 3.90% 0.00% 57.50% 38.55% NA
Indica Intermediate  786 31.00% 0.00% 39.06% 29.90% NA
Temperate Japonica  767 96.60% 2.20% 0.39% 0.78% NA
Tropical Japonica  504 99.00% 0.00% 0.60% 0.40% NA
Japonica Intermediate  241 80.90% 15.80% 2.90% 0.41% NA
VI/Aromatic  96 93.80% 0.00% 6.25% 0.00% NA
Intermediate  90 66.70% 1.10% 24.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412882680 T -> C LOC_Os04g22720.1 3_prime_UTR_variant ; 937.0bp to feature; MODIFIER silent_mutation Average:18.579; most accessible tissue: Callus, score: 40.578 N N N N
vg0412882680 T -> C LOC_Os04g22730.1 downstream_gene_variant ; 3779.0bp to feature; MODIFIER silent_mutation Average:18.579; most accessible tissue: Callus, score: 40.578 N N N N
vg0412882680 T -> DEL N N silent_mutation Average:18.579; most accessible tissue: Callus, score: 40.578 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412882680 NA 4.35E-06 mr1064 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 3.30E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 4.98E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 6.14E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 1.33E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 1.74E-54 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 4.52E-71 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 3.44E-83 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 7.09E-35 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 2.67E-72 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 7.54E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 6.91E-104 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 3.75E-104 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 7.00E-68 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680 NA 8.52E-64 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251