Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0412882680:

Variant ID: vg0412882680 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12882680
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGAAGCGCCACAAGCTGGTCATTGTGGAAGAACTTGTGAGAATGATGACCTCTGGCGTTTCTAGGATGTGCTAATGTCGAATTGCAAGCATTTAGAGAT[T/C]
AGGAATCTAGGATCATGTTATCAGACCTATTATAGTTGCTAGATTAATCAGTTTGATCAACTTACCTTCTGAGACTATTTTATTTATGTGTTATTGTCTA

Reverse complement sequence

TAGACAATAACACATAAATAAAATAGTCTCAGAAGGTAAGTTGATCAAACTGATTAATCTAGCAACTATAATAGGTCTGATAACATGATCCTAGATTCCT[A/G]
ATCTCTAAATGCTTGCAATTCGACATTAGCACATCCTAGAAACGCCAGAGGTCATCATTCTCACAAGTTCTTCCACAATGACCAGCTTGTGGCGCTTCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.20%	1.20%	28.33%	19.28%	NA
All Indica	2759	28.20%	0.00%	40.38%	31.39%	NA
All Japonica	1512	94.90%	3.60%	0.86%	0.60%	NA
Aus	269	20.80%	0.00%	68.40%	10.78%	NA
Indica I	595	49.60%	0.00%	28.57%	21.85%	NA
Indica II	465	43.90%	0.00%	24.09%	32.04%	NA
Indica III	913	3.90%	0.00%	57.50%	38.55%	NA
Indica Intermediate	786	31.00%	0.00%	39.06%	29.90%	NA
Temperate Japonica	767	96.60%	2.20%	0.39%	0.78%	NA
Tropical Japonica	504	99.00%	0.00%	0.60%	0.40%	NA
Japonica Intermediate	241	80.90%	15.80%	2.90%	0.41%	NA
VI/Aromatic	96	93.80%	0.00%	6.25%	0.00%	NA
Intermediate	90	66.70%	1.10%	24.44%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412882680	T -> C	LOC_Os04g22720.1	3_prime_UTR_variant ; 937.0bp to feature; MODIFIER	silent_mutation	Average:18.579; most accessible tissue: Callus, score: 40.578	N	N	N	N
vg0412882680	T -> C	LOC_Os04g22730.1	downstream_gene_variant ; 3779.0bp to feature; MODIFIER	silent_mutation	Average:18.579; most accessible tissue: Callus, score: 40.578	N	N	N	N
vg0412882680	T -> DEL	N	N	silent_mutation	Average:18.579; most accessible tissue: Callus, score: 40.578	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412882680	NA	4.35E-06	mr1064	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	3.30E-43	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	4.98E-14	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	6.14E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	1.33E-08	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	1.74E-54	mr1889	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	4.52E-71	mr1896	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	3.44E-83	mr1907	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	7.09E-35	mr1932	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	2.67E-72	mr1934	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	7.54E-59	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	6.91E-104	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	3.75E-104	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	7.00E-68	mr1889_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412882680	NA	8.52E-64	mr1896_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251