RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0412853605:

Variant ID: vg0412853605 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12853605
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGTGGGAATCCACTATCATCCTGGTAAGGCCAACGTGGTCGCCGACACTCTAAGTCGAAAAAGCCATTGCAACACTCTTGGCATCCGTGGCATTCCAC[C/T]
GGAACTTAATCAACAGATGGAAGCCCTGAACCTAAGCATAGTTGGTCGTGGATTCTTGGCTACGCTGGAAGCCAAGCCTACCTTGCTCGATCGAATCCGC

Reverse complement sequence

GCGGATTCGATCGAGCAAGGTAGGCTTGGCTTCCAGCGTAGCCAAGAATCCACGACCAACTATGCTTAGGTTCAGGGCTTCCATCTGTTGATTAAGTTCC[G/A]
GTGGAATGCCACGGATGCCAAGAGTGTTGCAATGGCTTTTTCGACTTAGAGTGTCGGCGACCACGTTGGCCTTACCAGGATGATAGTGGATTCCCACATC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	0.20%	0.85%	11.60%	NA
All Indica	2759	80.10%	0.40%	1.45%	18.12%	NA
All Japonica	1512	99.80%	0.00%	0.00%	0.20%	NA
Aus	269	84.40%	0.00%	0.00%	15.61%	NA
Indica I	595	86.90%	0.00%	1.68%	11.43%	NA
Indica II	465	77.80%	0.00%	1.51%	20.65%	NA
Indica III	913	76.00%	0.70%	1.53%	21.80%	NA
Indica Intermediate	786	80.90%	0.50%	1.15%	17.43%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	0.00%	0.00%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412853605	C -> DEL	LOC_Os04g22680.1	N	frameshift_variant	Average:15.042; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0412853605	C -> T	LOC_Os04g22680.1	missense_variant ; p.Pro786Leu; MODERATE	nonsynonymous_codon ; P786L	Average:15.042; most accessible tissue: Minghui63 root, score: 25.504	benign	0.764	TOLERATED	0.25

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412853605	NA	4.05E-08	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0412853605	6.82E-06	6.53E-09	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412853605	4.54E-06	4.82E-08	mr1114	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412853605	NA	1.71E-08	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412853605	NA	4.89E-11	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412853605	NA	1.85E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412853605	NA	7.83E-08	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412853605	NA	1.87E-07	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412853605	NA	5.73E-15	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412853605	NA	3.49E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 28 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0412853605:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact