\
| Variant ID: vg0412853605 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12853605 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATGTGGGAATCCACTATCATCCTGGTAAGGCCAACGTGGTCGCCGACACTCTAAGTCGAAAAAGCCATTGCAACACTCTTGGCATCCGTGGCATTCCAC[C/T]
GGAACTTAATCAACAGATGGAAGCCCTGAACCTAAGCATAGTTGGTCGTGGATTCTTGGCTACGCTGGAAGCCAAGCCTACCTTGCTCGATCGAATCCGC
GCGGATTCGATCGAGCAAGGTAGGCTTGGCTTCCAGCGTAGCCAAGAATCCACGACCAACTATGCTTAGGTTCAGGGCTTCCATCTGTTGATTAAGTTCC[G/A]
GTGGAATGCCACGGATGCCAAGAGTGTTGCAATGGCTTTTTCGACTTAGAGTGTCGGCGACCACGTTGGCCTTACCAGGATGATAGTGGATTCCCACATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 0.20% | 0.85% | 11.60% | NA |
| All Indica | 2759 | 80.10% | 0.40% | 1.45% | 18.12% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Aus | 269 | 84.40% | 0.00% | 0.00% | 15.61% | NA |
| Indica I | 595 | 86.90% | 0.00% | 1.68% | 11.43% | NA |
| Indica II | 465 | 77.80% | 0.00% | 1.51% | 20.65% | NA |
| Indica III | 913 | 76.00% | 0.70% | 1.53% | 21.80% | NA |
| Indica Intermediate | 786 | 80.90% | 0.50% | 1.15% | 17.43% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412853605 | C -> DEL | LOC_Os04g22680.1 | N | frameshift_variant | Average:15.042; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg0412853605 | C -> T | LOC_Os04g22680.1 | missense_variant ; p.Pro786Leu; MODERATE | nonsynonymous_codon ; P786L | Average:15.042; most accessible tissue: Minghui63 root, score: 25.504 | benign |
0.764 |
TOLERATED | 0.25 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412853605 | NA | 4.05E-08 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0412853605 | 6.82E-06 | 6.53E-09 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | 4.54E-06 | 4.82E-08 | mr1114 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 1.71E-08 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 4.89E-11 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 1.85E-06 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 7.83E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 1.87E-07 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 5.73E-15 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 3.49E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | 1.43E-06 | 5.99E-14 | mr1794 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 1.28E-09 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 6.15E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 1.01E-07 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 1.13E-07 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 1.16E-08 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 3.43E-09 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 4.72E-07 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 4.18E-13 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 3.92E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 9.23E-08 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 9.30E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 8.97E-08 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 1.41E-07 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 4.37E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | 3.46E-06 | 4.28E-17 | mr1495_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 4.82E-18 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412853605 | NA | 2.72E-14 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |