\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412793995:

Variant ID: vg0412793995 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12793995
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGCCGGTGTTCGTTATCGTCGTCTCCGTTCGTCCTCGTCGACGACTCCTCCGGTCGGTCGTTCGTCCTCGCCGGCTCGTCGTCTCGCTGCGCCGCCACC[A/G,C]
TCGTCGTCATCGCAGCGGCGTGTTCCGCGCCATCCTCGTCTCCATGAAGCTGCCGCCGGCTGCCCTCGTTGCCTCCTCGCCGGTCCCGGTCGTCATCCTC

Reverse complement sequence

GAGGATGACGACCGGGACCGGCGAGGAGGCAACGAGGGCAGCCGGCGGCAGCTTCATGGAGACGAGGATGGCGCGGAACACGCCGCTGCGATGACGACGA[T/C,G]
GGTGGCGGCGCAGCGAGACGACGAGCCGGCGAGGACGAACGACCGACCGGAGGAGTCGTCGACGAGGACGAACGGAGACGACGATAACGAACACCGGCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 0.70% 19.47% 24.16% G: 0.59%
All Indica  2759 31.90% 1.20% 27.69% 38.24% G: 1.01%
All Japonica  1512 99.20% 0.00% 0.46% 0.33% NA
Aus  269 25.30% 0.40% 51.67% 22.68% NA
Indica I  595 58.00% 1.70% 13.11% 26.05% G: 1.18%
Indica II  465 40.40% 0.60% 21.72% 36.77% G: 0.43%
Indica III  913 7.00% 1.50% 42.28% 47.86% G: 1.31%
Indica Intermediate  786 36.00% 0.60% 25.32% 37.15% G: 0.89%
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 97.10% 0.00% 0.83% 2.07% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 71.10% 0.00% 11.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412793995 A -> C LOC_Os04g22600.1 upstream_gene_variant ; 1544.0bp to feature; MODIFIER silent_mutation Average:17.099; most accessible tissue: Callus, score: 34.754 N N N N
vg0412793995 A -> C LOC_Os04g22590.1 downstream_gene_variant ; 1784.0bp to feature; MODIFIER silent_mutation Average:17.099; most accessible tissue: Callus, score: 34.754 N N N N
vg0412793995 A -> C LOC_Os04g22590-LOC_Os04g22600 intergenic_region ; MODIFIER silent_mutation Average:17.099; most accessible tissue: Callus, score: 34.754 N N N N
vg0412793995 A -> DEL N N silent_mutation Average:17.099; most accessible tissue: Callus, score: 34.754 N N N N
vg0412793995 A -> G LOC_Os04g22600.1 upstream_gene_variant ; 1544.0bp to feature; MODIFIER silent_mutation Average:17.099; most accessible tissue: Callus, score: 34.754 N N N N
vg0412793995 A -> G LOC_Os04g22590.1 downstream_gene_variant ; 1784.0bp to feature; MODIFIER silent_mutation Average:17.099; most accessible tissue: Callus, score: 34.754 N N N N
vg0412793995 A -> G LOC_Os04g22590-LOC_Os04g22600 intergenic_region ; MODIFIER silent_mutation Average:17.099; most accessible tissue: Callus, score: 34.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412793995 3.07E-07 3.89E-18 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 2.97E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 9.58E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 1.60E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 2.20E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 3.01E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 3.14E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 5.29E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 3.26E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 9.09E-09 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 1.40E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412793995 NA 8.09E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251