\
| Variant ID: vg0412793995 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12793995 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCGCCGGTGTTCGTTATCGTCGTCTCCGTTCGTCCTCGTCGACGACTCCTCCGGTCGGTCGTTCGTCCTCGCCGGCTCGTCGTCTCGCTGCGCCGCCACC[A/G,C]
TCGTCGTCATCGCAGCGGCGTGTTCCGCGCCATCCTCGTCTCCATGAAGCTGCCGCCGGCTGCCCTCGTTGCCTCCTCGCCGGTCCCGGTCGTCATCCTC
GAGGATGACGACCGGGACCGGCGAGGAGGCAACGAGGGCAGCCGGCGGCAGCTTCATGGAGACGAGGATGGCGCGGAACACGCCGCTGCGATGACGACGA[T/C,G]
GGTGGCGGCGCAGCGAGACGACGAGCCGGCGAGGACGAACGACCGACCGGAGGAGTCGTCGACGAGGACGAACGGAGACGACGATAACGAACACCGGCGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 0.70% | 19.47% | 24.16% | G: 0.59% |
| All Indica | 2759 | 31.90% | 1.20% | 27.69% | 38.24% | G: 1.01% |
| All Japonica | 1512 | 99.20% | 0.00% | 0.46% | 0.33% | NA |
| Aus | 269 | 25.30% | 0.40% | 51.67% | 22.68% | NA |
| Indica I | 595 | 58.00% | 1.70% | 13.11% | 26.05% | G: 1.18% |
| Indica II | 465 | 40.40% | 0.60% | 21.72% | 36.77% | G: 0.43% |
| Indica III | 913 | 7.00% | 1.50% | 42.28% | 47.86% | G: 1.31% |
| Indica Intermediate | 786 | 36.00% | 0.60% | 25.32% | 37.15% | G: 0.89% |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 71.10% | 0.00% | 11.11% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412793995 | A -> C | LOC_Os04g22600.1 | upstream_gene_variant ; 1544.0bp to feature; MODIFIER | silent_mutation | Average:17.099; most accessible tissue: Callus, score: 34.754 | N | N | N | N |
| vg0412793995 | A -> C | LOC_Os04g22590.1 | downstream_gene_variant ; 1784.0bp to feature; MODIFIER | silent_mutation | Average:17.099; most accessible tissue: Callus, score: 34.754 | N | N | N | N |
| vg0412793995 | A -> C | LOC_Os04g22590-LOC_Os04g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:17.099; most accessible tissue: Callus, score: 34.754 | N | N | N | N |
| vg0412793995 | A -> DEL | N | N | silent_mutation | Average:17.099; most accessible tissue: Callus, score: 34.754 | N | N | N | N |
| vg0412793995 | A -> G | LOC_Os04g22600.1 | upstream_gene_variant ; 1544.0bp to feature; MODIFIER | silent_mutation | Average:17.099; most accessible tissue: Callus, score: 34.754 | N | N | N | N |
| vg0412793995 | A -> G | LOC_Os04g22590.1 | downstream_gene_variant ; 1784.0bp to feature; MODIFIER | silent_mutation | Average:17.099; most accessible tissue: Callus, score: 34.754 | N | N | N | N |
| vg0412793995 | A -> G | LOC_Os04g22590-LOC_Os04g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:17.099; most accessible tissue: Callus, score: 34.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412793995 | 3.07E-07 | 3.89E-18 | mr1062 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 2.97E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 9.58E-16 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 1.60E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 2.20E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 3.01E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 3.14E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 5.29E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 3.26E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 9.09E-09 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 1.40E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412793995 | NA | 8.09E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |