\
| Variant ID: vg0412758955 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12758955 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 49. )
TCTCAGAAGTTTAGAGACATTTGGACACTTATTTTGTGAGATGTGTGGATATTTATAAAGATTATTCAGATTAAGCTATGTCCACACATAGGGGAGCAAT[G/A]
ACCATGTAAAAGCTCCAAAAATAGTCTCTTACTGCATAGTCGATGATGCAGTTAGATTTTAAAGCATGTTATGATTAATCATATATATAAGAATATTTCC
GGAAATATTCTTATATATATGATTAATCATAACATGCTTTAAAATCTAACTGCATCATCGACTATGCAGTAAGAGACTATTTTTGGAGCTTTTACATGGT[C/T]
ATTGCTCCCCTATGTGTGGACATAGCTTAATCTGAATAATCTTTATAAATATCCACACATCTCACAAAATAAGTGTCCAAATGTCTCTAAACTTCTGAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.60% | 9.10% | 15.07% | 39.21% | NA |
| All Indica | 2759 | 4.00% | 11.40% | 21.38% | 63.28% | NA |
| All Japonica | 1512 | 98.30% | 0.00% | 0.40% | 1.32% | NA |
| Aus | 269 | 0.40% | 42.80% | 36.06% | 20.82% | NA |
| Indica I | 595 | 3.20% | 9.90% | 12.10% | 74.79% | NA |
| Indica II | 465 | 8.20% | 6.50% | 15.91% | 69.46% | NA |
| Indica III | 913 | 1.90% | 16.00% | 31.11% | 51.04% | NA |
| Indica Intermediate | 786 | 4.50% | 10.10% | 20.36% | 65.14% | NA |
| Temperate Japonica | 767 | 98.60% | 0.00% | 0.39% | 1.04% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.40% | 0.79% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 0.41% | 3.32% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 4.17% | 7.29% | NA |
| Intermediate | 90 | 54.40% | 2.20% | 16.67% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412758955 | G -> DEL | N | N | silent_mutation | Average:9.218; most accessible tissue: Callus, score: 32.025 | N | N | N | N |
| vg0412758955 | G -> A | LOC_Os04g22520.1 | upstream_gene_variant ; 2011.0bp to feature; MODIFIER | silent_mutation | Average:9.218; most accessible tissue: Callus, score: 32.025 | N | N | N | N |
| vg0412758955 | G -> A | LOC_Os04g22510-LOC_Os04g22520 | intergenic_region ; MODIFIER | silent_mutation | Average:9.218; most accessible tissue: Callus, score: 32.025 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412758955 | NA | 1.37E-12 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412758955 | NA | 4.53E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412758955 | NA | 3.46E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412758955 | 1.71E-07 | 8.47E-07 | mr1887 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |