\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412757195:

Variant ID: vg0412757195 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12757195
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


TGGACCATAATTGACTTGGTTCATCATTCCACAAATCAATAAAAAATATAGAAGATTAAGAGGCAAAATAAGTAAGATCCTATTAATCTTGTCATTTGAT[G/A]
GCAAAGATGAAGCTTTACTAAGGGGTTGTAGCAACTCTAAATTTAATAATAATAAAGCTCACTTTCCTCGCAAGGGGAAATAAAATTGCCTCTATGTCCT

Reverse complement sequence

AGGACATAGAGGCAATTTTATTTCCCCTTGCGAGGAAAGTGAGCTTTATTATTATTAAATTTAGAGTTGCTACAACCCCTTAGTAAAGCTTCATCTTTGC[C/T]
ATCAAATGACAAGATTAATAGGATCTTACTTATTTTGCCTCTTAATCTTCTATATTTTTTATTGATTTGTGGAATGATGAACCAAGTCAATTATGGTCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 36.70% 7.81% 4.70% NA
All Indica  2759 76.00% 4.10% 12.00% 7.90% NA
All Japonica  1512 1.50% 98.00% 0.46% 0.07% NA
Aus  269 90.30% 1.10% 8.18% 0.37% NA
Indica I  595 79.20% 3.90% 11.09% 5.88% NA
Indica II  465 73.10% 8.80% 9.68% 8.39% NA
Indica III  913 77.20% 1.90% 16.43% 4.49% NA
Indica Intermediate  786 73.80% 4.20% 8.91% 13.10% NA
Temperate Japonica  767 1.00% 98.20% 0.65% 0.13% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 95.90% 0.83% 0.00% NA
VI/Aromatic  96 9.40% 88.50% 2.08% 0.00% NA
Intermediate  90 34.40% 55.60% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412757195 G -> DEL N N silent_mutation Average:11.898; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0412757195 G -> A LOC_Os04g22520.1 upstream_gene_variant ; 3771.0bp to feature; MODIFIER silent_mutation Average:11.898; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0412757195 G -> A LOC_Os04g22510-LOC_Os04g22520 intergenic_region ; MODIFIER silent_mutation Average:11.898; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412757195 NA 6.25E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412757195 NA 4.36E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412757195 NA 9.03E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412757195 1.43E-06 NA mr1935 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412757195 NA 6.19E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251