\
| Variant ID: vg0412701691 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12701691 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.03, others allele: 0.00, population size: 263. )
TAACAGACTCCCTCATGGAGGTGAATAAAAGGAAAGAAAAAAACCCAGAAAAGCTGCAGTCAGTTCGCACCACCAAAAACTCTGTTTTTCGTTTCAGTTC[T/A]
TCAGTTACTGTTCACGTCTGGAAAATATTCGGAGATTGTAGGTTAGCCACTGATCGAGAGCTGAGCTAGGGGTTTTTGCTGACAGTTACTTTATGGCTTG
CAAGCCATAAAGTAACTGTCAGCAAAAACCCCTAGCTCAGCTCTCGATCAGTGGCTAACCTACAATCTCCGAATATTTTCCAGACGTGAACAGTAACTGA[A/T]
GAACTGAAACGAAAAACAGAGTTTTTGGTGGTGCGAACTGACTGCAGCTTTTCTGGGTTTTTTTCTTTCCTTTTATTCACCTCCATGAGGGAGTCTGTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.00% | 35.90% | 0.13% | 0.02% | NA |
| All Indica | 2759 | 94.30% | 5.50% | 0.18% | 0.04% | NA |
| All Japonica | 1512 | 6.50% | 93.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 76.60% | 23.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 96.10% | 3.80% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.60% | 78.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 51.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412701691 | T -> DEL | N | N | silent_mutation | Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| vg0412701691 | T -> A | LOC_Os04g22420.1 | downstream_gene_variant ; 3863.0bp to feature; MODIFIER | silent_mutation | Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| vg0412701691 | T -> A | LOC_Os04g22430.1 | downstream_gene_variant ; 356.0bp to feature; MODIFIER | silent_mutation | Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| vg0412701691 | T -> A | LOC_Os04g22430-LOC_Os04g22440 | intergenic_region ; MODIFIER | silent_mutation | Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412701691 | NA | 1.03E-21 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | 1.89E-06 | 4.07E-07 | mr1193 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | NA | 4.66E-16 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | NA | 5.65E-08 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | 3.51E-06 | 2.56E-07 | mr1525 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | NA | 6.66E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | NA | 7.63E-13 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | NA | 3.94E-12 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | NA | 1.24E-26 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | NA | 2.94E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412701691 | 5.04E-06 | NA | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |