\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412701691:

Variant ID: vg0412701691 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12701691
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.03, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TAACAGACTCCCTCATGGAGGTGAATAAAAGGAAAGAAAAAAACCCAGAAAAGCTGCAGTCAGTTCGCACCACCAAAAACTCTGTTTTTCGTTTCAGTTC[T/A]
TCAGTTACTGTTCACGTCTGGAAAATATTCGGAGATTGTAGGTTAGCCACTGATCGAGAGCTGAGCTAGGGGTTTTTGCTGACAGTTACTTTATGGCTTG

Reverse complement sequence

CAAGCCATAAAGTAACTGTCAGCAAAAACCCCTAGCTCAGCTCTCGATCAGTGGCTAACCTACAATCTCCGAATATTTTCCAGACGTGAACAGTAACTGA[A/T]
GAACTGAAACGAAAAACAGAGTTTTTGGTGGTGCGAACTGACTGCAGCTTTTCTGGGTTTTTTTCTTTCCTTTTATTCACCTCCATGAGGGAGTCTGTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 35.90% 0.13% 0.02% NA
All Indica  2759 94.30% 5.50% 0.18% 0.04% NA
All Japonica  1512 6.50% 93.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 76.60% 23.20% 0.22% 0.00% NA
Indica III  913 98.90% 0.90% 0.22% 0.00% NA
Indica Intermediate  786 96.10% 3.80% 0.00% 0.13% NA
Temperate Japonica  767 5.20% 94.80% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 21.60% 78.40% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412701691 T -> DEL N N silent_mutation Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0412701691 T -> A LOC_Os04g22420.1 downstream_gene_variant ; 3863.0bp to feature; MODIFIER silent_mutation Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0412701691 T -> A LOC_Os04g22430.1 downstream_gene_variant ; 356.0bp to feature; MODIFIER silent_mutation Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0412701691 T -> A LOC_Os04g22430-LOC_Os04g22440 intergenic_region ; MODIFIER silent_mutation Average:63.247; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412701691 NA 1.03E-21 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 1.89E-06 4.07E-07 mr1193 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 NA 4.66E-16 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 NA 5.65E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 3.51E-06 2.56E-07 mr1525 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 NA 6.66E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 NA 7.63E-13 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 NA 3.94E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 NA 1.24E-26 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 NA 2.94E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412701691 5.04E-06 NA mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251