Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412664006:

Variant ID: vg0412664006 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12664006
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGAGTCCTGGTGATGCGGGGTGTGTATGTTGTTATGGGGGTTAGGAATTTATCTGCCGGTGCACGCGTGAGGGATGAGATATTGAAACAAGTTCCGTCT[G/A]
CAAAGATGGAGATTCTTAATCTTGACCTTAGCTCGATGTCATCCGTGAGGAGATTTGCAGAGATTTTCAAAGCTTTGAACCTTCCTTTGAACATTTTGAT

Reverse complement sequence

ATCAAAATGTTCAAAGGAAGGTTCAAAGCTTTGAAAATCTCTGCAAATCTCCTCACGGATGACATCGAGCTAAGGTCAAGATTAAGAATCTCCATCTTTG[C/T]
AGACGGAACTTGTTTCAATATCTCATCCCTCACGCGTGCACCGGCAGATAAATTCCTAACCCCCATAACAACATACACACCCCGCATCACCAGGACTCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.90% 5.20% 0.97% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 82.00% 15.10% 2.91% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 97.10% 2.10% 0.78% 0.00% NA
Tropical Japonica  504 60.50% 33.10% 6.35% 0.00% NA
Japonica Intermediate  241 78.80% 18.70% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412664006 G -> A LOC_Os04g22380.1 missense_variant ; p.Ala81Thr; MODERATE nonsynonymous_codon ; A81T Average:46.456; most accessible tissue: Callus, score: 65.756 possibly damaging 1.885 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412664006 NA 5.03E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 2.44E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 3.35E-20 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 8.57E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 8.12E-19 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 3.70E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 1.62E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 9.44E-09 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 1.06E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 1.20E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 4.72E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 9.90E-13 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 5.84E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 7.53E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 4.98E-23 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 1.03E-20 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 3.63E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 8.53E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 3.99E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 2.38E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 7.10E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 2.19E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 3.43E-06 3.03E-07 mr1849_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 5.91E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 2.22E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 2.47E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 8.33E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 9.44E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412664006 NA 8.12E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251