RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0412663837:

Variant ID: vg0412663837 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 12663837
Reference Allele: ACT	Alternative Allele: TCT,A
Primary Allele: TCT	Secondary Allele: ACT

Inferred Ancestral Allele : ACT (evidence from allele frequency in Oryza rufipogon: ACT: 1.00, A: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TGCAACATTAATCCCTTTGGTCAATGGGTGATGGATGATGCACAGTAATTTAATGCGCCATAAAAAAAATCCTAATCAAATTGTATTGCAGACCTGAATT[ACT/TCT,A]
GTTGGCATCATTGCTGATGGATATGTTTCTTGCAGGTGCCTCCAGTGGGATTGGGGCTGAAACATGCCGAGTCCTGGTGATGCGGGGTGTGTATGTTGTT

Reverse complement sequence

AACAACATACACACCCCGCATCACCAGGACTCGGCATGTTTCAGCCCCAATCCCACTGGAGGCACCTGCAAGAAACATATCCATCAGCAATGATGCCAAC[AGT/AGA,T]
AATTCAGGTCTGCAATACAATTTGATTAGGATTTTTTTTATGGCGCATTAAATTACTGTGCATCATCCATCACCCATTGACCAAAGGGATTAATGTTGCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of TCT(primary allele)	Frequency of ACT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	35.70%	0.08%	0.00%	A: 0.04%
All Indica	2759	94.50%	5.40%	0.11%	0.00%	NA
All Japonica	1512	6.90%	93.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	76.80%	23.20%	0.00%	0.00%	NA
Indica III	913	98.90%	0.90%	0.22%	0.00%	NA
Indica Intermediate	786	95.80%	4.10%	0.13%	0.00%	NA
Temperate Japonica	767	6.00%	94.00%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	22.00%	78.00%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	47.80%	48.90%	1.11%	0.00%	A: 2.22%

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412663837	ACT -> TCT	LOC_Os04g22370.1	downstream_gene_variant ; 3930.0bp to feature; MODIFIER	silent_mutation	Average:43.932; most accessible tissue: Zhenshan97 young leaf, score: 57.78	N	N	N	N
vg0412663837	ACT -> TCT	LOC_Os04g22380.1	intron_variant ; MODIFIER	silent_mutation	Average:43.932; most accessible tissue: Zhenshan97 young leaf, score: 57.78	N	N	N	N
vg0412663837	ACT -> A	LOC_Os04g22370.1	downstream_gene_variant ; 3931.0bp to feature; MODIFIER	silent_mutation	Average:43.932; most accessible tissue: Zhenshan97 young leaf, score: 57.78	N	N	N	N
vg0412663837	ACT -> A	LOC_Os04g22380.1	intron_variant ; MODIFIER	silent_mutation	Average:43.932; most accessible tissue: Zhenshan97 young leaf, score: 57.78	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412663837	NA	8.40E-22	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412663837	NA	2.43E-16	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412663837	NA	3.25E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412663837	4.95E-07	NA	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412663837	3.88E-06	NA	mr1549	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412663837	1.32E-07	2.99E-07	mr1550	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412663837	NA	1.51E-25	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 7 of 7 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0412663837:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact