Variant ID: vg0412663837 (JBrowse) | Variation Type: INDEL |
Chromosome: chr04 | Position: 12663837 |
Reference Allele: ACT | Alternative Allele: TCT,A |
Primary Allele: TCT | Secondary Allele: ACT |
Inferred Ancestral Allele : ACT (evidence from allele frequency in Oryza rufipogon: ACT: 1.00, A: 0.00, others allele: 0.00, population size: 250. )
TGCAACATTAATCCCTTTGGTCAATGGGTGATGGATGATGCACAGTAATTTAATGCGCCATAAAAAAAATCCTAATCAAATTGTATTGCAGACCTGAATT[ACT/TCT,A]
GTTGGCATCATTGCTGATGGATATGTTTCTTGCAGGTGCCTCCAGTGGGATTGGGGCTGAAACATGCCGAGTCCTGGTGATGCGGGGTGTGTATGTTGTT
AACAACATACACACCCCGCATCACCAGGACTCGGCATGTTTCAGCCCCAATCCCACTGGAGGCACCTGCAAGAAACATATCCATCAGCAATGATGCCAAC[AGT/AGA,T]
AATTCAGGTCTGCAATACAATTTGATTAGGATTTTTTTTATGGCGCATTAAATTACTGTGCATCATCCATCACCCATTGACCAAAGGGATTAATGTTGCA
Populations | Population Size | Frequency of TCT(primary allele) | Frequency of ACT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 64.20% | 35.70% | 0.08% | 0.00% | A: 0.04% |
All Indica | 2759 | 94.50% | 5.40% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 6.90% | 93.10% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 95.80% | 4.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 22.00% | 78.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
Intermediate | 90 | 47.80% | 48.90% | 1.11% | 0.00% | A: 2.22% |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0412663837 | ACT -> TCT | LOC_Os04g22370.1 | downstream_gene_variant ; 3930.0bp to feature; MODIFIER | silent_mutation | Average:43.932; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
vg0412663837 | ACT -> TCT | LOC_Os04g22380.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.932; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
vg0412663837 | ACT -> A | LOC_Os04g22370.1 | downstream_gene_variant ; 3931.0bp to feature; MODIFIER | silent_mutation | Average:43.932; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
vg0412663837 | ACT -> A | LOC_Os04g22380.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.932; most accessible tissue: Zhenshan97 young leaf, score: 57.78 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0412663837 | NA | 8.40E-22 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412663837 | NA | 2.43E-16 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412663837 | NA | 3.25E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412663837 | 4.95E-07 | NA | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412663837 | 3.88E-06 | NA | mr1549 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412663837 | 1.32E-07 | 2.99E-07 | mr1550 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412663837 | NA | 1.51E-25 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |