\
| Variant ID: vg0412575333 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12575333 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 50. )
TACCACAACCATGAGTACACACCGATCTATCAAAGAATAAAGTCCACGGCACTATATCAACTGAGCCAATTGAATCATTATGATGTTCCACAATAAAATC[G/A]
GCCATAGCTTGTCCCTTAATTGCCTTCAACGACTCATACCGAAGATCAAACTCGGTTAAGGAAAATATCCACTTTTCAACCCTTCCTTTCAATATTGGAG
CTCCAATATTGAAAGGAAGGGTTGAAAAGTGGATATTTTCCTTAACCGAGTTTGATCTTCGGTATGAGTCGTTGAAGGCAATTAAGGGACAAGCTATGGC[C/T]
GATTTTATTGTGGAACATCATAATGATTCAATTGGCTCAGTTGATATAGTGCCGTGGACTTTATTCTTTGATAGATCGGTGTGTACTCATGGTTGTGGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.20% | 11.90% | 1.27% | 57.62% | NA |
| All Indica | 2759 | 8.80% | 0.50% | 0.80% | 89.82% | NA |
| All Japonica | 1512 | 57.80% | 34.80% | 2.05% | 5.36% | NA |
| Aus | 269 | 51.70% | 0.40% | 0.74% | 47.21% | NA |
| Indica I | 595 | 0.70% | 0.20% | 1.18% | 97.98% | NA |
| Indica II | 465 | 18.90% | 1.30% | 1.08% | 78.71% | NA |
| Indica III | 913 | 9.50% | 0.30% | 0.22% | 89.92% | NA |
| Indica Intermediate | 786 | 8.30% | 0.60% | 1.02% | 90.08% | NA |
| Temperate Japonica | 767 | 91.10% | 3.30% | 2.09% | 3.52% | NA |
| Tropical Japonica | 504 | 12.70% | 84.30% | 1.98% | 0.99% | NA |
| Japonica Intermediate | 241 | 46.10% | 31.50% | 2.07% | 20.33% | NA |
| VI/Aromatic | 96 | 92.70% | 5.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 38.90% | 16.70% | 5.56% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412575333 | G -> DEL | LOC_Os04g22200.1 | N | frameshift_variant | Average:8.453; most accessible tissue: Callus, score: 27.862 | N | N | N | N |
| vg0412575333 | G -> A | LOC_Os04g22200.1 | synonymous_variant ; p.Ala1084Ala; LOW | synonymous_codon | Average:8.453; most accessible tissue: Callus, score: 27.862 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412575333 | 1.26E-07 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | 7.13E-08 | NA | mr1140 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | 5.55E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 1.71E-22 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | 4.49E-06 | NA | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 1.53E-18 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 3.19E-10 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 3.15E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 7.25E-10 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | 5.70E-08 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 8.50E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | 2.35E-06 | NA | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 1.49E-12 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 1.45E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 3.65E-09 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 5.13E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | 4.07E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 1.55E-19 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 1.14E-06 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | 2.21E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 1.86E-12 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 3.81E-10 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 2.91E-29 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412575333 | NA | 1.97E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |