RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0412570492:

Variant ID: vg0412570492 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12570492
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCAACGCGTATCGTCTAGTAAGAAAGTTCACTGGGATGAGATTGGAATCGGCCAAGCGCTTGCTCTCACCATAGCCAATTCTGCTAAGGATGAACCTCT[G/A]
ATGGCTACCGCCACCTACTTTTGGTCCAACACCATCAATGCTTTCTTATTCAACCAAGGGCCGATGACTCCAACTTTAATCGACATCACCATGATTACTG

Reverse complement sequence

CAGTAATCATGGTGATGTCGATTAAAGTTGGAGTCATCGGCCCTTGGTTGAATAAGAAAGCATTGATGGTGTTGGACCAAAAGTAGGTGGCGGTAGCCAT[C/T]
AGAGGTTCATCCTTAGCAGAATTGGCTATGGTGAGAGCAAGCGCTTGGCCGATTCCAATCTCATCCCAGTGAACTTTCTTACTAGACGATACGCGTTGGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.40%	0.30%	0.42%	56.92%	NA
All Indica	2759	10.40%	0.40%	0.62%	88.58%	NA
All Japonica	1512	94.60%	0.10%	0.00%	5.29%	NA
Aus	269	51.70%	0.00%	1.12%	47.21%	NA
Indica I	595	2.50%	0.00%	0.67%	96.81%	NA
Indica II	465	22.20%	0.00%	0.43%	77.42%	NA
Indica III	913	10.70%	0.70%	0.00%	88.61%	NA
Indica Intermediate	786	9.00%	0.60%	1.40%	88.93%	NA
Temperate Japonica	767	96.60%	0.00%	0.00%	3.39%	NA
Tropical Japonica	504	98.80%	0.20%	0.00%	0.99%	NA
Japonica Intermediate	241	79.70%	0.00%	0.00%	20.33%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	58.90%	0.00%	0.00%	41.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412570492	G -> DEL	LOC_Os04g22190.1	N	frameshift_variant	Average:7.612; most accessible tissue: Callus, score: 18.442	N	N	N	N
vg0412570492	G -> A	LOC_Os04g22190.1	synonymous_variant ; p.Leu123Leu; LOW	synonymous_codon	Average:7.612; most accessible tissue: Callus, score: 18.442	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412570492	NA	1.23E-08	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492	NA	6.98E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492	3.54E-06	3.96E-10	mr1116	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492	NA	7.31E-15	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492	NA	3.26E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492	NA	1.11E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492	NA	7.88E-08	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492	NA	4.76E-17	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492	NA	3.92E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492	9.93E-06	2.56E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 18 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0412570492:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact