\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412570492:

Variant ID: vg0412570492 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12570492
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCAACGCGTATCGTCTAGTAAGAAAGTTCACTGGGATGAGATTGGAATCGGCCAAGCGCTTGCTCTCACCATAGCCAATTCTGCTAAGGATGAACCTCT[G/A]
ATGGCTACCGCCACCTACTTTTGGTCCAACACCATCAATGCTTTCTTATTCAACCAAGGGCCGATGACTCCAACTTTAATCGACATCACCATGATTACTG

Reverse complement sequence

CAGTAATCATGGTGATGTCGATTAAAGTTGGAGTCATCGGCCCTTGGTTGAATAAGAAAGCATTGATGGTGTTGGACCAAAAGTAGGTGGCGGTAGCCAT[C/T]
AGAGGTTCATCCTTAGCAGAATTGGCTATGGTGAGAGCAAGCGCTTGGCCGATTCCAATCTCATCCCAGTGAACTTTCTTACTAGACGATACGCGTTGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 0.30% 0.42% 56.92% NA
All Indica  2759 10.40% 0.40% 0.62% 88.58% NA
All Japonica  1512 94.60% 0.10% 0.00% 5.29% NA
Aus  269 51.70% 0.00% 1.12% 47.21% NA
Indica I  595 2.50% 0.00% 0.67% 96.81% NA
Indica II  465 22.20% 0.00% 0.43% 77.42% NA
Indica III  913 10.70% 0.70% 0.00% 88.61% NA
Indica Intermediate  786 9.00% 0.60% 1.40% 88.93% NA
Temperate Japonica  767 96.60% 0.00% 0.00% 3.39% NA
Tropical Japonica  504 98.80% 0.20% 0.00% 0.99% NA
Japonica Intermediate  241 79.70% 0.00% 0.00% 20.33% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 58.90% 0.00% 0.00% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412570492 G -> DEL LOC_Os04g22190.1 N frameshift_variant Average:7.612; most accessible tissue: Callus, score: 18.442 N N N N
vg0412570492 G -> A LOC_Os04g22190.1 synonymous_variant ; p.Leu123Leu; LOW synonymous_codon Average:7.612; most accessible tissue: Callus, score: 18.442 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412570492 NA 1.23E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 6.98E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 3.54E-06 3.96E-10 mr1116 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 7.31E-15 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 3.26E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 1.11E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 7.88E-08 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 4.76E-17 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 3.92E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 9.93E-06 2.56E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 7.35E-09 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 8.77E-10 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 9.15E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 2.94E-11 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 4.99E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 8.67E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 2.61E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412570492 NA 4.71E-15 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251