\
| Variant ID: vg0412540776 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12540776 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, A: 0.41, others allele: 0.00, population size: 92. )
GAACACAACCTAAGGCTAGTCACAAGCTGCCAACTCAACCTTATGACCCTTGTTATGTTCACATTGGATGCCCTATGTTTTCGTAAAATGATTTTATCTC[A/T]
TATGTTACTTATCCAATCGATTATTCGATTATACCGTTATTTTTGTCACAATTAAATATTTACAATAAGATATCACTCAAATATATTTCGATGAAAAAAT
ATTTTTTCATCGAAATATATTTGAGTGATATCTTATTGTAAATATTTAATTGTGACAAAAATAACGGTATAATCGAATAATCGATTGGATAAGTAACATA[T/A]
GAGATAAAATCATTTTACGAAAACATAGGGCATCCAATGTGAACATAACAAGGGTCATAAGGTTGAGTTGGCAGCTTGTGACTAGCCTTAGGTTGTGTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.40% | 29.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 52.30% | 47.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 25.20% | 74.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 68.60% | 31.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 59.70% | 40.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.30% | 18.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412540776 | A -> T | LOC_Os04g22120.1 | upstream_gene_variant ; 1129.0bp to feature; MODIFIER | silent_mutation | Average:38.071; most accessible tissue: Callus, score: 80.209 | N | N | N | N |
| vg0412540776 | A -> T | LOC_Os04g22120-LOC_Os04g22130 | intergenic_region ; MODIFIER | silent_mutation | Average:38.071; most accessible tissue: Callus, score: 80.209 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412540776 | NA | 4.24E-09 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412540776 | NA | 5.38E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412540776 | NA | 8.42E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412540776 | 3.31E-06 | 2.92E-10 | mr1830 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412540776 | 4.56E-06 | NA | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412540776 | 2.47E-06 | 2.05E-12 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412540776 | NA | 2.64E-12 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412540776 | 5.23E-08 | 1.39E-15 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412540776 | 2.28E-08 | 7.50E-25 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |