Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412540776:

Variant ID: vg0412540776 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12540776
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, A: 0.41, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

GAACACAACCTAAGGCTAGTCACAAGCTGCCAACTCAACCTTATGACCCTTGTTATGTTCACATTGGATGCCCTATGTTTTCGTAAAATGATTTTATCTC[A/T]
TATGTTACTTATCCAATCGATTATTCGATTATACCGTTATTTTTGTCACAATTAAATATTTACAATAAGATATCACTCAAATATATTTCGATGAAAAAAT

Reverse complement sequence

ATTTTTTCATCGAAATATATTTGAGTGATATCTTATTGTAAATATTTAATTGTGACAAAAATAACGGTATAATCGAATAATCGATTGGATAAGTAACATA[T/A]
GAGATAAAATCATTTTACGAAAACATAGGGCATCCAATGTGAACATAACAAGGGTCATAAGGTTGAGTTGGCAGCTTGTGACTAGCCTTAGGTTGTGTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.40%	29.50%	0.04%	0.00%	NA
All Indica	2759	52.30%	47.70%	0.07%	0.00%	NA
All Japonica	1512	95.40%	4.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	25.20%	74.60%	0.17%	0.00%	NA
Indica II	465	68.60%	31.40%	0.00%	0.00%	NA
Indica III	913	55.20%	44.80%	0.00%	0.00%	NA
Indica Intermediate	786	59.70%	40.20%	0.13%	0.00%	NA
Temperate Japonica	767	96.90%	3.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	81.30%	18.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412540776	A -> T	LOC_Os04g22120.1	upstream_gene_variant ; 1129.0bp to feature; MODIFIER	silent_mutation	Average:38.071; most accessible tissue: Callus, score: 80.209	N	N	N	N
vg0412540776	A -> T	LOC_Os04g22120-LOC_Os04g22130	intergenic_region ; MODIFIER	silent_mutation	Average:38.071; most accessible tissue: Callus, score: 80.209	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412540776	NA	4.24E-09	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776	NA	5.38E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776	NA	8.42E-06	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776	3.31E-06	2.92E-10	mr1830	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776	4.56E-06	NA	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776	2.47E-06	2.05E-12	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776	NA	2.64E-12	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776	5.23E-08	1.39E-15	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776	2.28E-08	7.50E-25	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251