Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412540776:

Variant ID: vg0412540776 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12540776
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, A: 0.41, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GAACACAACCTAAGGCTAGTCACAAGCTGCCAACTCAACCTTATGACCCTTGTTATGTTCACATTGGATGCCCTATGTTTTCGTAAAATGATTTTATCTC[A/T]
TATGTTACTTATCCAATCGATTATTCGATTATACCGTTATTTTTGTCACAATTAAATATTTACAATAAGATATCACTCAAATATATTTCGATGAAAAAAT

Reverse complement sequence

ATTTTTTCATCGAAATATATTTGAGTGATATCTTATTGTAAATATTTAATTGTGACAAAAATAACGGTATAATCGAATAATCGATTGGATAAGTAACATA[T/A]
GAGATAAAATCATTTTACGAAAACATAGGGCATCCAATGTGAACATAACAAGGGTCATAAGGTTGAGTTGGCAGCTTGTGACTAGCCTTAGGTTGTGTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 29.50% 0.04% 0.00% NA
All Indica  2759 52.30% 47.70% 0.07% 0.00% NA
All Japonica  1512 95.40% 4.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 25.20% 74.60% 0.17% 0.00% NA
Indica II  465 68.60% 31.40% 0.00% 0.00% NA
Indica III  913 55.20% 44.80% 0.00% 0.00% NA
Indica Intermediate  786 59.70% 40.20% 0.13% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 81.30% 18.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412540776 A -> T LOC_Os04g22120.1 upstream_gene_variant ; 1129.0bp to feature; MODIFIER silent_mutation Average:38.071; most accessible tissue: Callus, score: 80.209 N N N N
vg0412540776 A -> T LOC_Os04g22120-LOC_Os04g22130 intergenic_region ; MODIFIER silent_mutation Average:38.071; most accessible tissue: Callus, score: 80.209 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412540776 NA 4.24E-09 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776 NA 5.38E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776 NA 8.42E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776 3.31E-06 2.92E-10 mr1830 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776 4.56E-06 NA mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776 2.47E-06 2.05E-12 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776 NA 2.64E-12 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776 5.23E-08 1.39E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412540776 2.28E-08 7.50E-25 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251