\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412537881:

Variant ID: vg0412537881 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 12537881
Reference Allele: CAlternative Allele: T,CCA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTACTCCCATCCAGCAGCTCTCCTCTGTCATTTACTGATTACTATAATTTGAGTGACTTCAAATGTTCAATACCCTTCCCTATTCTCTTTTCCGGTTC[C/T,CCA]
CAATTTAGACGACTAGATTTGATTTTGTACCTTCCGATACTATTACCTACCGGTACAATCCGCCGGACTGGAGCAATCATCTACTCATAATTCATGCACC

Reverse complement sequence

GGTGCATGAATTATGAGTAGATGATTGCTCCAGTCCGGCGGATTGTACCGGTAGGTAATAGTATCGGAAGGTACAAAATCAAATCTAGTCGTCTAAATTG[G/A,TGG]
GAACCGGAAAAGAGAATAGGGAAGGGTATTGAACATTTGAAGTCACTCAAATTATAGTAATCAGTAAATGACAGAGGAGAGCTGCTGGATGGGAGTAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 7.90% 4.27% 2.31% NA
All Indica  2759 95.70% 0.40% 1.01% 2.86% NA
All Japonica  1512 64.00% 23.20% 10.98% 1.85% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 80.20% 1.10% 4.30% 14.41% NA
Indica III  913 99.50% 0.20% 0.11% 0.22% NA
Indica Intermediate  786 97.30% 0.50% 0.89% 1.27% NA
Temperate Japonica  767 96.00% 1.80% 2.22% 0.00% NA
Tropical Japonica  504 12.50% 54.60% 27.58% 5.36% NA
Japonica Intermediate  241 69.70% 25.70% 4.15% 0.41% NA
VI/Aromatic  96 94.80% 3.10% 2.08% 0.00% NA
Intermediate  90 81.10% 10.00% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412537881 C -> DEL N N silent_mutation Average:93.358; most accessible tissue: Zhenshan97 young leaf, score: 98.703 N N N N
vg0412537881 C -> CCA LOC_Os04g22120.1 intron_variant ; MODIFIER N Average:93.358; most accessible tissue: Zhenshan97 young leaf, score: 98.703 N N N N
vg0412537881 C -> T LOC_Os04g22120.1 intron_variant ; MODIFIER silent_mutation Average:93.358; most accessible tissue: Zhenshan97 young leaf, score: 98.703 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0412537881 C CCA -0.11 -0.16 -0.2 -0.13 -0.15 -0.24
vg0412537881 C T 0.01 -0.03 -0.04 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412537881 NA 3.95E-21 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412537881 NA 3.43E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412537881 NA 5.39E-09 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412537881 NA 3.48E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412537881 1.78E-06 3.55E-13 mr1905 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412537881 NA 7.16E-06 mr1905 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412537881 NA 7.84E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412537881 NA 1.89E-18 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412537881 NA 3.82E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251