\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412534399:

Variant ID: vg0412534399 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12534399
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CAAATATTACAAGCAGATTGGAATGAGTTATTGCAACATGGGAGTATATCCTTTATCTACCATGTGCCATCTACCAGTACGGCAGTACCAACTGACCAAC[T/A]
TCTAATATAACCAAAACCCTCATTCTCTTGGGCTCAAGCTGTCATTGTTAGCCATGGCCGATGGCAAGCTAGAGCTGGACGACAGCGTCGCCGTCGCAAG

Reverse complement sequence

CTTGCGACGGCGACGCTGTCGTCCAGCTCTAGCTTGCCATCGGCCATGGCTAACAATGACAGCTTGAGCCCAAGAGAATGAGGGTTTTGGTTATATTAGA[A/T]
GTTGGTCAGTTGGTACTGCCGTACTGGTAGATGGCACATGGTAGATAAAGGATATACTCCCATGTTGCAATAACTCATTCCAATCTGCTTGTAATATTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.30% 0.06% 0.00% NA
All Indica  2759 49.50% 50.40% 0.11% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 75.10% 24.70% 0.17% 0.00% NA
Indica II  465 34.80% 64.90% 0.22% 0.00% NA
Indica III  913 45.70% 54.30% 0.00% 0.00% NA
Indica Intermediate  786 43.30% 56.60% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412534399 T -> A LOC_Os04g22120.1 3_prime_UTR_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:67.711; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N
vg0412534399 T -> A LOC_Os04g22110.1 downstream_gene_variant ; 2931.0bp to feature; MODIFIER silent_mutation Average:67.711; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412534399 NA 1.76E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 NA 7.72E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 NA 6.19E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 NA 2.62E-17 mr1386 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 2.53E-06 1.36E-09 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 NA 1.01E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 NA 1.63E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 NA 1.37E-17 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 NA 5.81E-09 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 3.30E-08 8.56E-25 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 2.14E-06 3.13E-12 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 NA 3.88E-16 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 NA 2.01E-11 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 1.99E-09 3.67E-42 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399 3.00E-08 2.22E-24 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251