Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412534399:

Variant ID: vg0412534399 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12534399
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

CAAATATTACAAGCAGATTGGAATGAGTTATTGCAACATGGGAGTATATCCTTTATCTACCATGTGCCATCTACCAGTACGGCAGTACCAACTGACCAAC[T/A]
TCTAATATAACCAAAACCCTCATTCTCTTGGGCTCAAGCTGTCATTGTTAGCCATGGCCGATGGCAAGCTAGAGCTGGACGACAGCGTCGCCGTCGCAAG

Reverse complement sequence

CTTGCGACGGCGACGCTGTCGTCCAGCTCTAGCTTGCCATCGGCCATGGCTAACAATGACAGCTTGAGCCCAAGAGAATGAGGGTTTTGGTTATATTAGA[A/T]
GTTGGTCAGTTGGTACTGCCGTACTGGTAGATGGCACATGGTAGATAAAGGATATACTCCCATGTTGCAATAACTCATTCCAATCTGCTTGTAATATTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	36.30%	0.06%	0.00%	NA
All Indica	2759	49.50%	50.40%	0.11%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	75.10%	24.70%	0.17%	0.00%	NA
Indica II	465	34.80%	64.90%	0.22%	0.00%	NA
Indica III	913	45.70%	54.30%	0.00%	0.00%	NA
Indica Intermediate	786	43.30%	56.60%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412534399	T -> A	LOC_Os04g22120.1	3_prime_UTR_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:67.711; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N
vg0412534399	T -> A	LOC_Os04g22110.1	downstream_gene_variant ; 2931.0bp to feature; MODIFIER	silent_mutation	Average:67.711; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412534399	NA	1.76E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	NA	7.72E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	NA	6.19E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	NA	2.62E-17	mr1386	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	2.53E-06	1.36E-09	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	NA	1.01E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	NA	1.63E-08	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	NA	1.37E-17	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	NA	5.81E-09	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	3.30E-08	8.56E-25	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	2.14E-06	3.13E-12	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	NA	3.88E-16	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	NA	2.01E-11	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	1.99E-09	3.67E-42	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412534399	3.00E-08	2.22E-24	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251