Search for Variation information by Variation ID:
Detailed information for vg0412512760:
| Variant ID: vg0412512760 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 12512760 |
| Reference Allele: CA | Alternative Allele: C,GA,CCAATCTGAAGTTGCAGCAA |
| Primary Allele: CA | Secondary Allele: GA |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
ATTAGATTTTTGATGGATTCCATCTCTGCATCTCTCCCATACATTTTGGGCTCAAGAGGATAAGATGATGTTATTGCATTTGGGGCCAGGGGTGTACTCT[CA/C,GA,CCAATCTGAAGTTGCAGCAA]
CACCTCTGATTTAAACTTGCATACCCACATAGCCTCATAACCCCATTTACAGCCTCTTGTAACTGATGAGTCATATGTTGGATCATGTTGGAGAGTTCAC
Reverse complement sequence
GTGAACTCTCCAACATGATCCAACATATGACTCATCAGTTACAAGAGGCTGTAAATGGGGTTATGAGGCTATGTGGGTATGCAAGTTTAAATCAGAGGTG[TG/G,TC,TTGCTGCAACTTCAGATTGG]
AGAGTACACCCCTGGCCCCAAATGCAATAACATCATCTTATCCTCTTGAGCCCAAAATGTATGGGAGAGATGCAGAGATGGAATCCATCAAAAATCTAAT
Allele Frequencies:
| Populations | Population Size | Frequency of CA(primary allele) | Frequency of GA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 10.50% | 3.66% | 34.68% | C: 1.16% |
| All Indica | 2759 | 25.60% | 14.80% | 5.36% | 52.34% | C: 1.99% |
| All Japonica | 1512 | 96.60% | 0.10% | 0.73% | 2.58% | NA |
| Aus | 269 | 19.30% | 27.90% | 2.97% | 49.81% | NA |
| Indica I | 595 | 48.10% | 6.10% | 9.24% | 31.60% | C: 5.04% |
| Indica II | 465 | 29.70% | 4.90% | 3.44% | 60.65% | C: 1.29% |
| Indica III | 913 | 7.00% | 25.50% | 3.18% | 63.75% | C: 0.55% |
| Indica Intermediate | 786 | 27.60% | 14.60% | 6.11% | 49.87% | C: 1.78% |
| Temperate Japonica | 767 | 99.50% | 0.30% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 91.70% | 0.00% | 1.98% | 6.35% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 91.70% | 4.20% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 64.40% | 8.90% | 5.56% | 21.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412512760 | CA -> C | LOC_Os04g22090.1 | frameshift_variant ; p.Cys54fs; HIGH | frameshift_variant | Average:14.736; most accessible tissue: Callus, score: 68.608 | N | N | N | N |
| vg0412512760 | CA -> DEL | LOC_Os04g22090.1 | N | frameshift_variant | Average:14.736; most accessible tissue: Callus, score: 68.608 | N | N | N | N |
| vg0412512760 | CA -> CCAATCTGAAGTTGCAGCAA | LOC_Os04g22090.1 | inframe_insertion ; p.Cys54_Glu55insCysCysAsnPheAr gLeu; MODERATE | N | Average:14.736; most accessible tissue: Callus, score: 68.608 | N | N | N | N |
| vg0412512760 | CA -> GA | LOC_Os04g22090.1 | missense_variant ; p.Glu55Gln; MODERATE | nonsynonymous_codon ; E55H | Average:14.736; most accessible tissue: Callus, score: 68.608 | probably damaging  |
+2.140 |
N | N |
| vg0412512760 | CA -> GA | LOC_Os04g22090.1 | missense_variant ; p.Glu55Gln; MODERATE | nonsynonymous_codon ; E55Q | Average:14.736; most accessible tissue: Callus, score: 68.608 | benign |
+1.135 |
N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412512760 | 2.16E-07 | 8.49E-09 | mr1115_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512760 | NA | 1.99E-06 | mr1134_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512760 | NA | 5.50E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512760 | NA | 2.50E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512760 | NA | 8.68E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512760 | NA | 6.90E-07 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412512760 | NA | 4.73E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |