\
| Variant ID: vg0412479470 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12479470 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.05, others allele: 0.00, population size: 127. )
CGGATCTAAATCTCCGACAACGAAGATGGCTGGAACTAATCAAAGATTATGACATGAGCATTCACTACCATCCGGGTAAAGCCAATGTGGTGGCAGATGC[T/A]
TTAAGCAGGAAAAGCTACTGCAATGCCCTATGCACCGAGGACATGTGTGAAGAATTGCAGCAGGAGCTTGAACGTCTCAACGTGGGAATCGTTGAACACA
TGTGTTCAACGATTCCCACGTTGAGACGTTCAAGCTCCTGCTGCAATTCTTCACACATGTCCTCGGTGCATAGGGCATTGCAGTAGCTTTTCCTGCTTAA[A/T]
GCATCTGCCACCACATTGGCTTTACCCGGATGGTAGTGAATGCTCATGTCATAATCTTTGATTAGTTCCAGCCATCTTCGTTGTCGGAGATTTAGATCCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 36.70% | 6.07% | 7.49% | NA |
| All Indica | 2759 | 23.60% | 56.90% | 10.04% | 9.42% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 20.10% | 45.40% | 1.86% | 32.71% | NA |
| Indica I | 595 | 47.40% | 31.10% | 10.92% | 10.59% | NA |
| Indica II | 465 | 23.90% | 69.90% | 3.66% | 2.58% | NA |
| Indica III | 913 | 6.00% | 67.50% | 14.57% | 11.94% | NA |
| Indica Intermediate | 786 | 26.00% | 56.50% | 7.89% | 9.67% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 5.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 28.90% | 3.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412479470 | T -> DEL | LOC_Os04g22030.1 | N | frameshift_variant | Average:35.133; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg0412479470 | T -> A | LOC_Os04g22030.1 | synonymous_variant ; p.Ala648Ala; LOW | synonymous_codon | Average:35.133; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412479470 | 9.16E-07 | NA | mr1071 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 2.89E-07 | 1.39E-84 | mr1080 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 7.09E-06 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | NA | 8.41E-28 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 4.50E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | NA | 1.36E-34 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 4.25E-06 | 3.97E-78 | mr1613 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 4.29E-06 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | NA | 1.72E-26 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | NA | 8.06E-52 | mr1795 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | NA | 7.35E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | NA | 3.53E-61 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 6.24E-08 | 1.38E-104 | mr1071_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 5.60E-08 | 2.27E-106 | mr1080_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 1.28E-06 | 6.25E-103 | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | NA | 1.23E-14 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 4.76E-07 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 4.14E-07 | 2.76E-120 | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 3.96E-07 | 1.10E-101 | mr1619_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412479470 | 9.23E-06 | NA | mr1962_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |