RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0412479443:

Variant ID: vg0412479443 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12479443
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGTCTGAAATACATCTTCACCCAACCGGATCTAAATCTCCGACAACGAAGATGGCTGGAACTAATCAAAGATTATGACATGAGCATTCACTACCATCC[G/A]
GGTAAAGCCAATGTGGTGGCAGATGCTTTAAGCAGGAAAAGCTACTGCAATGCCCTATGCACCGAGGACATGTGTGAAGAATTGCAGCAGGAGCTTGAAC

Reverse complement sequence

GTTCAAGCTCCTGCTGCAATTCTTCACACATGTCCTCGGTGCATAGGGCATTGCAGTAGCTTTTCCTGCTTAAAGCATCTGCCACCACATTGGCTTTACC[C/T]
GGATGGTAGTGAATGCTCATGTCATAATCTTTGATTAGTTCCAGCCATCTTCGTTGTCGGAGATTTAGATCCGGTTGGGTGAAGATGTATTTCAGACTCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	3.30%	4.30%	7.83%	NA
All Indica	2759	77.50%	5.30%	6.74%	10.51%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	64.30%	2.20%	5.58%	27.88%	NA
Indica I	595	76.80%	5.90%	6.39%	10.92%	NA
Indica II	465	92.70%	1.90%	2.37%	3.01%	NA
Indica III	913	68.50%	6.70%	11.06%	13.80%	NA
Indica Intermediate	786	79.50%	5.10%	4.58%	10.81%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	88.90%	4.40%	1.11%	5.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412479443	G -> DEL	LOC_Os04g22030.1	N	frameshift_variant	Average:34.431; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg0412479443	G -> A	LOC_Os04g22030.1	synonymous_variant ; p.Pro639Pro; LOW	synonymous_codon	Average:34.431; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412479443	5.95E-06	NA	mr1186_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412479443	7.41E-08	5.96E-08	mr1186_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412479443	NA	5.64E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412479443	NA	1.01E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412479443	3.14E-07	9.88E-08	mr1648_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412479443	NA	1.18E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412479443	NA	6.36E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412479443	NA	8.43E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0412479443:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact