Variant ID: vg0412478616 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 12478616 |
Reference Allele: T | Alternative Allele: G |
Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 97. )
AGACCTGCGATCAGGCTATCACCAGTTGAGAATTCGGGAAGAGGATATTCCGAAGAAAGCCTTCACCACTCGGTATGGGTTGTATGAGTGCACGCTTATG[T/G]
CTTTCGGACTTACCAACGCACCCGCATTCTTCATGAATCTGATGAACAAAGTGTTCATGGAATTTCTGGACAAGTTTGTTGTGGTATTCATCGACGACAT
ATGTCGTCGATGAATACCACAACAAACTTGTCCAGAAATTCCATGAACACTTTGTTCATCAGATTCATGAAGAATGCGGGTGCGTTGGTAAGTCCGAAAG[A/C]
CATAAGCGTGCACTCATACAACCCATACCGAGTGGTGAAGGCTTTCTTCGGAATATCCTCTTCCCGAATTCTCAACTGGTGATAGCCTGATCGCAGGTCT
Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 52.80% | 0.50% | 31.99% | 14.66% | NA |
All Indica | 2759 | 27.80% | 0.90% | 49.69% | 21.60% | NA |
All Japonica | 1512 | 99.30% | 0.10% | 0.66% | 0.00% | NA |
Aus | 269 | 27.50% | 0.00% | 39.41% | 33.09% | NA |
Indica I | 595 | 50.30% | 0.20% | 27.23% | 22.35% | NA |
Indica II | 465 | 29.00% | 1.10% | 61.51% | 8.39% | NA |
Indica III | 913 | 10.10% | 0.70% | 59.36% | 29.90% | NA |
Indica Intermediate | 786 | 30.80% | 1.50% | 48.47% | 19.21% | NA |
Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 99.00% | 0.00% | 0.99% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 0.00% | 1.66% | 0.00% | NA |
VI/Aromatic | 96 | 94.80% | 0.00% | 4.17% | 1.04% | NA |
Intermediate | 90 | 68.90% | 0.00% | 23.33% | 7.78% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0412478616 | T -> DEL | LOC_Os04g22030.1 | N | frameshift_variant | Average:16.907; most accessible tissue: Zhenshan97 flower, score: 22.37 | N | N | N | N |
vg0412478616 | T -> G | LOC_Os04g22030.1 | missense_variant ; p.Ser440Ala; MODERATE | nonsynonymous_codon ; S440A | Average:16.907; most accessible tissue: Zhenshan97 flower, score: 22.37 | benign | 1.305 | DELETERIOUS | 0.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0412478616 | 7.33E-06 | 1.89E-10 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412478616 | 5.75E-06 | 2.53E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412478616 | 1.51E-06 | NA | mr1070 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412478616 | 1.27E-07 | 2.24E-07 | mr1070 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412478616 | 4.52E-06 | 5.23E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412478616 | NA | 9.63E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412478616 | NA | 4.85E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412478616 | NA | 1.53E-06 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412478616 | NA | 3.10E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |