Variant ID: vg0412476851 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 12476851 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGTTCGTGCTAGTTGCAATGGGTTACTTCACTAAGTGAGCCGAAGCCGTGCCGCTCGAGAATATTACTACGGAGGTAATTGGCTTTATTTTGAAGCATAT[C/T]
GTTCATAGATTCGGTATTCCTCAAACATTAAAGGAGCTTCTTTTATGTCCAAGGAAGTGAGAAGTTTTGCCGAATCTTATGATATTAAGTTGTTGAGTTC
GAACTCAACAACTTAATATCATAAGATTCGGCAAAACTTCTCACTTCCTTGGACATAAAAGAAGCTCCTTTAATGTTTGAGGAATACCGAATCTATGAAC[G/A]
ATATGCTTCAAAATAAAGCCAATTACCTCCGTAGTAATATTCTCGAGCGGCACGGCTTCGGCTCACTTAGTGAAGTAACCCATTGCAACTAGCACGAACC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.40% | 1.10% | 5.35% | 0.17% | NA |
All Indica | 2759 | 94.40% | 0.60% | 4.93% | 0.11% | NA |
All Japonica | 1512 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
Aus | 269 | 46.50% | 13.00% | 39.41% | 1.12% | NA |
Indica I | 595 | 95.30% | 0.00% | 4.71% | 0.00% | NA |
Indica II | 465 | 97.20% | 0.60% | 1.94% | 0.22% | NA |
Indica III | 913 | 94.10% | 0.70% | 5.15% | 0.11% | NA |
Indica Intermediate | 786 | 92.40% | 0.90% | 6.62% | 0.13% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
Japonica Intermediate | 241 | 98.80% | 0.00% | 0.83% | 0.41% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 88.90% | 1.10% | 10.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0412476851 | C -> DEL | N | N | silent_mutation | Average:12.418; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
vg0412476851 | C -> T | LOC_Os04g22020.1 | downstream_gene_variant ; 2577.0bp to feature; MODIFIER | silent_mutation | Average:12.418; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
vg0412476851 | C -> T | LOC_Os04g22030.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.418; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0412476851 | NA | 1.40E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412476851 | 8.99E-06 | 8.99E-06 | mr1682 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412476851 | 7.83E-06 | NA | mr1754 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412476851 | 4.36E-06 | 6.55E-06 | mr1754 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412476851 | NA | 3.62E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412476851 | NA | 1.31E-08 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |