\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412457639:

Variant ID: vg0412457639 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12457639
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGCCAGGGTCCTGCTTCAACTATGGCGAGCTTGGCCACTTCGCTGACAAATGCCCGAAGCCAAGGCGTGCCGGGCTAAGGTTTGTCCAGGCTCGTGTC[A/C]
ACCACGCGTCCGCAGAGGAGGCGCAAGCAGCACCAGAGGTCGTACTGGGTACGTTTCCTGTTAACTCAATCCCTGCAATAGTACTTTTTGATTCTGGTGC

Reverse complement sequence

GCACCAGAATCAAAAAGTACTATTGCAGGGATTGAGTTAACAGGAAACGTACCCAGTACGACCTCTGGTGCTGCTTGCGCCTCCTCTGCGGACGCGTGGT[T/G]
GACACGAGCCTGGACAAACCTTAGCCCGGCACGCCTTGGCTTCGGGCATTTGTCAGCGAAGTGGCCAAGCTCGCCATAGTTGAAGCAGGACCCTGGCTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 17.90% 8.51% 6.45% NA
All Indica  2759 45.90% 30.30% 13.30% 10.51% NA
All Japonica  1512 99.50% 0.00% 0.40% 0.13% NA
Aus  269 88.10% 1.10% 8.18% 2.60% NA
Indica I  595 66.20% 12.30% 13.78% 7.73% NA
Indica II  465 35.70% 48.80% 7.74% 7.74% NA
Indica III  913 35.40% 33.20% 17.31% 14.13% NA
Indica Intermediate  786 48.90% 29.50% 11.58% 10.05% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.20% 0.00% 0.60% 0.20% NA
Japonica Intermediate  241 98.80% 0.00% 0.83% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 76.70% 8.90% 7.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412457639 A -> C LOC_Os04g22000.1 missense_variant ; p.Asn689His; MODERATE nonsynonymous_codon Average:10.025; most accessible tissue: Callus, score: 26.727 probably damaging 2.62 DELETERIOUS 0.00
vg0412457639 A -> DEL LOC_Os04g22000.1 N frameshift_variant Average:10.025; most accessible tissue: Callus, score: 26.727 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412457639 6.43E-07 1.26E-10 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 2.35E-07 3.45E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 8.50E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 NA 7.58E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 8.58E-06 NA mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 NA 2.46E-10 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 NA 7.13E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 1.36E-06 5.65E-11 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 4.98E-08 9.76E-11 mr1053_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 7.26E-08 2.80E-08 mr1053_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 9.93E-07 NA mr1070_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 4.56E-06 NA mr1076_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 NA 9.38E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 4.73E-07 2.54E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 3.44E-07 5.50E-07 mr1147_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 5.43E-06 7.14E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 4.02E-06 1.69E-07 mr1250_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 5.12E-06 5.12E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 8.40E-06 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 3.30E-06 2.13E-06 mr1264_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 3.68E-06 NA mr1437_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 NA 1.71E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457639 NA 3.08E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251