\
| Variant ID: vg0412455905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12455905 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 99. )
AGGGTCTCCCCGCGCCAAGAGGAGTCCTGATCCGCACCACGCCCGGCAAGTCGACGACGGCACCCGTGTGCATTCAACTTGCGCCCAGGAACCCACCTCC[G/A]
CCTGCAGCTCCCGCAGCTCCTCCAGTTCTGCCCCACAGTTGCCGCAGCTCCTGCAGCTCCAGAGCCAGTCCCAGCTCATGTTCCAGTGTCAGCTCCCGTG
CACGGGAGCTGACACTGGAACATGAGCTGGGACTGGCTCTGGAGCTGCAGGAGCTGCGGCAACTGTGGGGCAGAACTGGAGGAGCTGCGGGAGCTGCAGG[C/T]
GGAGGTGGGTTCCTGGGCGCAAGTTGAATGCACACGGGTGCCGTCGTCGACTTGCCGGGCGTGGTGCGGATCAGGACTCCTCTTGGCGCGGGGAGACCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.90% | 6.50% | 10.56% | 3.00% | NA |
| All Indica | 2759 | 71.10% | 10.60% | 16.67% | 1.56% | NA |
| All Japonica | 1512 | 99.30% | 0.60% | 0.00% | 0.07% | NA |
| Aus | 269 | 52.00% | 1.10% | 11.15% | 35.69% | NA |
| Indica I | 595 | 74.10% | 3.00% | 22.18% | 0.67% | NA |
| Indica II | 465 | 61.30% | 20.90% | 16.99% | 0.86% | NA |
| Indica III | 913 | 73.70% | 9.70% | 15.01% | 1.53% | NA |
| Indica Intermediate | 786 | 71.80% | 11.30% | 14.25% | 2.67% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 4.17% | 1.04% | NA |
| Intermediate | 90 | 88.90% | 4.40% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412455905 | G -> DEL | LOC_Os04g22000.1 | N | frameshift_variant | Average:24.273; most accessible tissue: Callus, score: 35.944 | N | N | N | N |
| vg0412455905 | G -> A | LOC_Os04g22000.1 | synonymous_variant ; p.Pro210Pro; LOW | synonymous_codon | Average:24.273; most accessible tissue: Callus, score: 35.944 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412455905 | 8.20E-07 | 2.53E-11 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | 1.70E-07 | 1.89E-08 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | 8.73E-06 | NA | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | 5.63E-07 | 5.25E-07 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | 9.19E-06 | 1.55E-06 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | 3.51E-06 | 5.28E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 1.64E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 3.68E-06 | mr1145 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | 1.42E-07 | 3.16E-08 | mr1147 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 1.30E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 8.61E-06 | mr1252 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 8.92E-06 | mr1433 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 5.84E-06 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 2.00E-07 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 3.30E-09 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 5.00E-08 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 7.99E-07 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | 4.65E-06 | 3.20E-09 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 6.43E-07 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | 6.94E-06 | NA | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 2.42E-06 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412455905 | NA | 3.57E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |