\
| Variant ID: vg0412436211 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12436211 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTAAAACTTCATATTCTGTAATGTTTCGAAAGATGTAGGTTATGGACCTGACAATTTTGAGTTAGAATTCGAAATTAGGTGGCACAATGTGGATAATCTC[T/C]
AAGTAATTAAACAGTGGAGTAGATCTCTTAATAGTGGGCAAGTTATACTTGCTGCCTAAAACACGGTCTCCAGGCAAATATATTCTGGTGAATATACCGC
GCGGTATATTCACCAGAATATATTTGCCTGGAGACCGTGTTTTAGGCAGCAAGTATAACTTGCCCACTATTAAGAGATCTACTCCACTGTTTAATTACTT[A/G]
GAGATTATCCACATTGTGCCACCTAATTTCGAATTCTAACTCAAAATTGTCAGGTCCATAACCTACATCTTTCGAAACATTACAGAATATGAAGTTTTAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 3.90% | 22.13% | 17.77% | NA |
| All Indica | 2759 | 32.40% | 3.80% | 34.87% | 28.92% | NA |
| All Japonica | 1512 | 94.40% | 4.80% | 0.53% | 0.33% | NA |
| Aus | 269 | 69.90% | 1.10% | 19.70% | 9.29% | NA |
| Indica I | 595 | 17.80% | 0.30% | 24.37% | 57.48% | NA |
| Indica II | 465 | 29.50% | 4.70% | 37.85% | 27.96% | NA |
| Indica III | 913 | 45.80% | 6.10% | 40.53% | 7.56% | NA |
| Indica Intermediate | 786 | 29.60% | 3.20% | 34.48% | 32.70% | NA |
| Temperate Japonica | 767 | 95.60% | 4.20% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.79% | 0.40% | NA |
| Japonica Intermediate | 241 | 81.30% | 16.60% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 7.29% | 1.04% | NA |
| Intermediate | 90 | 67.80% | 2.20% | 17.78% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412436211 | T -> C | LOC_Os04g21960.1 | upstream_gene_variant ; 1538.0bp to feature; MODIFIER | silent_mutation | Average:12.334; most accessible tissue: Callus, score: 20.868 | N | N | N | N |
| vg0412436211 | T -> C | LOC_Os04g21970.1 | upstream_gene_variant ; 187.0bp to feature; MODIFIER | silent_mutation | Average:12.334; most accessible tissue: Callus, score: 20.868 | N | N | N | N |
| vg0412436211 | T -> C | LOC_Os04g21980.1 | upstream_gene_variant ; 1437.0bp to feature; MODIFIER | silent_mutation | Average:12.334; most accessible tissue: Callus, score: 20.868 | N | N | N | N |
| vg0412436211 | T -> C | LOC_Os04g21970-LOC_Os04g21980 | intergenic_region ; MODIFIER | silent_mutation | Average:12.334; most accessible tissue: Callus, score: 20.868 | N | N | N | N |
| vg0412436211 | T -> DEL | N | N | silent_mutation | Average:12.334; most accessible tissue: Callus, score: 20.868 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412436211 | NA | 9.60E-06 | mr1351_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412436211 | 5.23E-06 | 5.23E-06 | mr1591_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412436211 | 1.68E-06 | 2.93E-06 | mr1594_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412436211 | 8.42E-06 | 8.20E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412436211 | 9.71E-06 | NA | mr1960_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412436211 | 4.76E-06 | NA | mr1960_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |