Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412436211:

Variant ID: vg0412436211 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12436211
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAAAACTTCATATTCTGTAATGTTTCGAAAGATGTAGGTTATGGACCTGACAATTTTGAGTTAGAATTCGAAATTAGGTGGCACAATGTGGATAATCTC[T/C]
AAGTAATTAAACAGTGGAGTAGATCTCTTAATAGTGGGCAAGTTATACTTGCTGCCTAAAACACGGTCTCCAGGCAAATATATTCTGGTGAATATACCGC

Reverse complement sequence

GCGGTATATTCACCAGAATATATTTGCCTGGAGACCGTGTTTTAGGCAGCAAGTATAACTTGCCCACTATTAAGAGATCTACTCCACTGTTTAATTACTT[A/G]
GAGATTATCCACATTGTGCCACCTAATTTCGAATTCTAACTCAAAATTGTCAGGTCCATAACCTACATCTTTCGAAACATTACAGAATATGAAGTTTTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	3.90%	22.13%	17.77%	NA
All Indica	2759	32.40%	3.80%	34.87%	28.92%	NA
All Japonica	1512	94.40%	4.80%	0.53%	0.33%	NA
Aus	269	69.90%	1.10%	19.70%	9.29%	NA
Indica I	595	17.80%	0.30%	24.37%	57.48%	NA
Indica II	465	29.50%	4.70%	37.85%	27.96%	NA
Indica III	913	45.80%	6.10%	40.53%	7.56%	NA
Indica Intermediate	786	29.60%	3.20%	34.48%	32.70%	NA
Temperate Japonica	767	95.60%	4.20%	0.00%	0.26%	NA
Tropical Japonica	504	98.80%	0.00%	0.79%	0.40%	NA
Japonica Intermediate	241	81.30%	16.60%	1.66%	0.41%	NA
VI/Aromatic	96	91.70%	0.00%	7.29%	1.04%	NA
Intermediate	90	67.80%	2.20%	17.78%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412436211	T -> C	LOC_Os04g21960.1	upstream_gene_variant ; 1538.0bp to feature; MODIFIER	silent_mutation	Average:12.334; most accessible tissue: Callus, score: 20.868	N	N	N	N
vg0412436211	T -> C	LOC_Os04g21970.1	upstream_gene_variant ; 187.0bp to feature; MODIFIER	silent_mutation	Average:12.334; most accessible tissue: Callus, score: 20.868	N	N	N	N
vg0412436211	T -> C	LOC_Os04g21980.1	upstream_gene_variant ; 1437.0bp to feature; MODIFIER	silent_mutation	Average:12.334; most accessible tissue: Callus, score: 20.868	N	N	N	N
vg0412436211	T -> C	LOC_Os04g21970-LOC_Os04g21980	intergenic_region ; MODIFIER	silent_mutation	Average:12.334; most accessible tissue: Callus, score: 20.868	N	N	N	N
vg0412436211	T -> DEL	N	N	silent_mutation	Average:12.334; most accessible tissue: Callus, score: 20.868	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412436211	NA	9.60E-06	mr1351_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211	5.23E-06	5.23E-06	mr1591_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211	1.68E-06	2.93E-06	mr1594_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211	8.42E-06	8.20E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211	9.71E-06	NA	mr1960_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211	4.76E-06	NA	mr1960_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251