\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412436211:

Variant ID: vg0412436211 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12436211
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAAAACTTCATATTCTGTAATGTTTCGAAAGATGTAGGTTATGGACCTGACAATTTTGAGTTAGAATTCGAAATTAGGTGGCACAATGTGGATAATCTC[T/C]
AAGTAATTAAACAGTGGAGTAGATCTCTTAATAGTGGGCAAGTTATACTTGCTGCCTAAAACACGGTCTCCAGGCAAATATATTCTGGTGAATATACCGC

Reverse complement sequence

GCGGTATATTCACCAGAATATATTTGCCTGGAGACCGTGTTTTAGGCAGCAAGTATAACTTGCCCACTATTAAGAGATCTACTCCACTGTTTAATTACTT[A/G]
GAGATTATCCACATTGTGCCACCTAATTTCGAATTCTAACTCAAAATTGTCAGGTCCATAACCTACATCTTTCGAAACATTACAGAATATGAAGTTTTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 3.90% 22.13% 17.77% NA
All Indica  2759 32.40% 3.80% 34.87% 28.92% NA
All Japonica  1512 94.40% 4.80% 0.53% 0.33% NA
Aus  269 69.90% 1.10% 19.70% 9.29% NA
Indica I  595 17.80% 0.30% 24.37% 57.48% NA
Indica II  465 29.50% 4.70% 37.85% 27.96% NA
Indica III  913 45.80% 6.10% 40.53% 7.56% NA
Indica Intermediate  786 29.60% 3.20% 34.48% 32.70% NA
Temperate Japonica  767 95.60% 4.20% 0.00% 0.26% NA
Tropical Japonica  504 98.80% 0.00% 0.79% 0.40% NA
Japonica Intermediate  241 81.30% 16.60% 1.66% 0.41% NA
VI/Aromatic  96 91.70% 0.00% 7.29% 1.04% NA
Intermediate  90 67.80% 2.20% 17.78% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412436211 T -> C LOC_Os04g21960.1 upstream_gene_variant ; 1538.0bp to feature; MODIFIER silent_mutation Average:12.334; most accessible tissue: Callus, score: 20.868 N N N N
vg0412436211 T -> C LOC_Os04g21970.1 upstream_gene_variant ; 187.0bp to feature; MODIFIER silent_mutation Average:12.334; most accessible tissue: Callus, score: 20.868 N N N N
vg0412436211 T -> C LOC_Os04g21980.1 upstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:12.334; most accessible tissue: Callus, score: 20.868 N N N N
vg0412436211 T -> C LOC_Os04g21970-LOC_Os04g21980 intergenic_region ; MODIFIER silent_mutation Average:12.334; most accessible tissue: Callus, score: 20.868 N N N N
vg0412436211 T -> DEL N N silent_mutation Average:12.334; most accessible tissue: Callus, score: 20.868 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412436211 NA 9.60E-06 mr1351_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211 5.23E-06 5.23E-06 mr1591_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211 1.68E-06 2.93E-06 mr1594_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211 8.42E-06 8.20E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211 9.71E-06 NA mr1960_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412436211 4.76E-06 NA mr1960_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251