\
| Variant ID: vg0412432479 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12432479 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCCATAAAGATATGCTGTCACTACGTCCATCTACTGTATAAATAGACGATTTTGTACTGCCAATGATATTAAATATCGGAAAGTTATACCACTCATAACT[G/A]
GAGAGTAAGTTTCATTGAAATCAACGCCAGGTTTTTGCGTAAAACCTTGTGCTACAAGCCTTGCTTTATATCTCACCACCTCGTTGTTTTCGTTCCGTTT
AAACGGAACGAAAACAACGAGGTGGTGAGATATAAAGCAAGGCTTGTAGCACAAGGTTTTACGCAAAAACCTGGCGTTGATTTCAATGAAACTTACTCTC[C/T]
AGTTATGAGTGGTATAACTTTCCGATATTTAATATCATTGGCAGTACAAAATCGTCTATTTATACAGTAGATGGACGTAGTGACAGCATATCTTTATGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.20% | 9.60% | 25.20% | 18.03% | NA |
| All Indica | 2759 | 36.00% | 0.60% | 38.35% | 25.08% | NA |
| All Japonica | 1512 | 65.30% | 27.90% | 3.90% | 2.91% | NA |
| Aus | 269 | 44.60% | 0.00% | 20.07% | 35.32% | NA |
| Indica I | 595 | 25.20% | 0.50% | 34.12% | 40.17% | NA |
| Indica II | 465 | 20.90% | 1.30% | 52.04% | 25.81% | NA |
| Indica III | 913 | 52.10% | 0.30% | 32.86% | 14.68% | NA |
| Indica Intermediate | 786 | 34.20% | 0.60% | 39.82% | 25.32% | NA |
| Temperate Japonica | 767 | 97.10% | 1.20% | 1.17% | 0.52% | NA |
| Tropical Japonica | 504 | 15.10% | 69.80% | 8.13% | 6.94% | NA |
| Japonica Intermediate | 241 | 68.90% | 25.30% | 3.73% | 2.07% | NA |
| VI/Aromatic | 96 | 90.60% | 2.10% | 2.08% | 5.21% | NA |
| Intermediate | 90 | 47.80% | 14.40% | 20.00% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412432479 | G -> DEL | N | N | silent_mutation | Average:7.752; most accessible tissue: Callus, score: 13.324 | N | N | N | N |
| vg0412432479 | G -> A | LOC_Os04g21970.1 | downstream_gene_variant ; 2472.0bp to feature; MODIFIER | silent_mutation | Average:7.752; most accessible tissue: Callus, score: 13.324 | N | N | N | N |
| vg0412432479 | G -> A | LOC_Os04g21960.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.752; most accessible tissue: Callus, score: 13.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412432479 | NA | 3.26E-24 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 7.17E-14 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 4.42E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 8.14E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 3.21E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 6.94E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 2.64E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | 1.15E-06 | 8.35E-06 | mr1807 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 2.52E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 4.66E-08 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 5.14E-10 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 8.06E-13 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 3.05E-20 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 3.80E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 1.95E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 1.07E-15 | mr1539_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 1.24E-17 | mr1540_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 1.14E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 1.21E-15 | mr1732_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 3.88E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 3.24E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 4.20E-10 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412432479 | NA | 2.31E-11 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |