Variant ID: vg0412431746 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 12431746 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.08, others allele: 0.00, population size: 118. )
CCTGGTTCTTTTTAAAGAAAAGTCCAAGATCTCTTGTGCCATTAAGATATCGAAAGACATTCTTAACTCCAGTCCAATGGTGTTTGGTAGGAGCAGCGCT[A/G]
TATCTTGCTAATAGATTAACCGAGAAAGCAATATCTGGCCTTGTACTATTTGCAAGGTACATAAGTGCGCCAATAGCACTAAGATATGGAAAATCAGGAC
GTCCTGATTTTCCATATCTTAGTGCTATTGGCGCACTTATGTACCTTGCAAATAGTACAAGGCCAGATATTGCTTTCTCGGTTAATCTATTAGCAAGATA[T/C]
AGCGCTGCTCCTACCAAACACCATTGGACTGGAGTTAAGAATGTCTTTCGATATCTTAATGGCACAAGAGATCTTGGACTTTTCTTTAAAAAGAACCAGG
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 37.30% | 27.40% | 24.29% | 10.94% | NA |
All Indica | 2759 | 4.80% | 44.60% | 39.29% | 11.27% | NA |
All Japonica | 1512 | 99.00% | 0.50% | 0.26% | 0.20% | NA |
Aus | 269 | 0.40% | 12.30% | 15.61% | 71.75% | NA |
Indica I | 595 | 5.20% | 17.50% | 57.98% | 19.33% | NA |
Indica II | 465 | 6.00% | 57.00% | 27.74% | 9.25% | NA |
Indica III | 913 | 3.90% | 58.10% | 32.86% | 5.15% | NA |
Indica Intermediate | 786 | 4.80% | 42.20% | 39.44% | 13.49% | NA |
Temperate Japonica | 767 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
Tropical Japonica | 504 | 98.60% | 0.60% | 0.79% | 0.00% | NA |
Japonica Intermediate | 241 | 97.90% | 1.20% | 0.00% | 0.83% | NA |
VI/Aromatic | 96 | 88.50% | 6.20% | 1.04% | 4.17% | NA |
Intermediate | 90 | 54.40% | 20.00% | 18.89% | 6.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0412431746 | A -> DEL | LOC_Os04g21960.1 | N | frameshift_variant | Average:13.925; most accessible tissue: Minghui63 young leaf, score: 29.964 | N | N | N | N |
vg0412431746 | A -> G | LOC_Os04g21960.1 | synonymous_variant ; p.Tyr653Tyr; LOW | synonymous_codon | Average:13.925; most accessible tissue: Minghui63 young leaf, score: 29.964 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0412431746 | NA | 5.06E-35 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412431746 | NA | 2.02E-15 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412431746 | 1.19E-07 | NA | mr1071_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412431746 | 1.87E-07 | NA | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412431746 | 4.40E-06 | NA | mr1100_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412431746 | 3.62E-09 | 4.82E-09 | mr1203_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412431746 | NA | 2.31E-17 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412431746 | 4.82E-06 | NA | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |