Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0412409796:

Variant ID: vg0412409796 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12409796
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAATGAGTGAAGATTGTAATTGACTGAGTAGAGAAATAAGTGAAGAAATTAAATGGGAGATGGTTATTTTCTTAGAGAAGGATATTTTTTTACCCAAT[C/G]
TTTACATTCAATCGGATGTATATAGCTTTTTTAAATTAGGAACTTAGCCCCTCAAATAACTCAATCTAAAATTCGCTCTTATGAAAATGGTTGTTATTGG

Reverse complement sequence

CCAATAACAACCATTTTCATAAGAGCGAATTTTAGATTGAGTTATTTGAGGGGCTAAGTTCCTAATTTAAAAAAGCTATATACATCCGATTGAATGTAAA[G/C]
ATTGGGTAAAAAAATATCCTTCTCTAAGAAAATAACCATCTCCCATTTAATTTCTTCACTTATTTCTCTACTCAGTCAATTACAATCTTCACTCATTTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.50%	26.60%	6.41%	27.55%	NA
All Indica	2759	7.90%	45.20%	6.74%	40.20%	NA
All Japonica	1512	99.10%	0.10%	0.13%	0.66%	NA
Aus	269	4.10%	0.00%	38.66%	57.25%	NA
Indica I	595	3.00%	72.80%	1.68%	22.52%	NA
Indica II	465	22.80%	26.90%	3.23%	47.10%	NA
Indica III	913	4.90%	41.90%	11.72%	41.40%	NA
Indica Intermediate	786	6.20%	38.80%	6.87%	48.09%	NA
Temperate Japonica	767	99.60%	0.10%	0.13%	0.13%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	98.30%	0.00%	0.41%	1.24%	NA
VI/Aromatic	96	88.50%	0.00%	5.21%	6.25%	NA
Intermediate	90	57.80%	10.00%	6.67%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412409796	C -> DEL	N	N	silent_mutation	Average:55.336; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg0412409796	C -> G	LOC_Os04g21920.1	upstream_gene_variant ; 2588.0bp to feature; MODIFIER	silent_mutation	Average:55.336; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg0412409796	C -> G	LOC_Os04g21910.1	downstream_gene_variant ; 1926.0bp to feature; MODIFIER	silent_mutation	Average:55.336; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg0412409796	C -> G	LOC_Os04g21910-LOC_Os04g21920	intergenic_region ; MODIFIER	silent_mutation	Average:55.336; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412409796	2.54E-06	NA	mr1386	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412409796	2.48E-06	2.02E-09	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412409796	NA	2.19E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412409796	NA	5.32E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412409796	NA	1.46E-07	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412409796	4.41E-07	NA	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412409796	6.89E-07	3.68E-12	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412409796	NA	6.90E-10	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412409796	9.43E-08	4.24E-13	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412409796	4.06E-06	7.75E-22	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251