\
| Variant ID: vg0412260112 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12260112 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.03, others allele: 0.00, population size: 94. )
ATGTCCTTCCTATGTTGTACCACTCTTTTTCGTAAGAACGTTTGTAAACTATGTTTTTTTTCTCAAAAGTCTTCTATGTAAAAAATATACTCCTTGTCTT[G/C]
ATGGGCCCATAAACACCGGTTGACATAGTCAACCACCTCAGTGAAGCTCTGTTGTAAATTAACCTCGTTCACCATGGATGGATCAAGGAACCCAACTTGA
TCAAGTTGGGTTCCTTGATCCATCCATGGTGAACGAGGTTAATTTACAACAGAGCTTCACTGAGGTGGTTGACTATGTCAACCGGTGTTTATGGGCCCAT[C/G]
AAGACAAGGAGTATATTTTTTACATAGAAGACTTTTGAGAAAAAAAACATAGTTTACAAACGTTCTTACGAAAAAGAGTGGTACAACATAGGAAGGACAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.50% | 27.20% | 19.11% | 3.15% | NA |
| All Indica | 2759 | 42.20% | 40.10% | 14.50% | 3.19% | NA |
| All Japonica | 1512 | 67.10% | 0.90% | 28.51% | 3.44% | NA |
| Aus | 269 | 50.90% | 48.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 48.60% | 24.90% | 23.70% | 2.86% | NA |
| Indica II | 465 | 41.10% | 48.40% | 9.46% | 1.08% | NA |
| Indica III | 913 | 43.40% | 36.10% | 15.12% | 5.37% | NA |
| Indica Intermediate | 786 | 36.80% | 51.30% | 9.80% | 2.16% | NA |
| Temperate Japonica | 767 | 85.40% | 0.40% | 13.56% | 0.65% | NA |
| Tropical Japonica | 504 | 43.10% | 1.00% | 49.01% | 6.94% | NA |
| Japonica Intermediate | 241 | 59.30% | 2.50% | 33.20% | 4.98% | NA |
| VI/Aromatic | 96 | 30.20% | 4.20% | 56.25% | 9.38% | NA |
| Intermediate | 90 | 46.70% | 34.40% | 18.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412260112 | G -> C | LOC_Os04g21670.1 | missense_variant ; p.Gln176Glu; MODERATE | nonsynonymous_codon ; Q176E | Average:32.789; most accessible tissue: Zhenshan97 flower, score: 45.068 | benign |
0.215 |
DELETERIOUS | 0.02 |
| vg0412260112 | G -> DEL | LOC_Os04g21670.1 | N | frameshift_variant | Average:32.789; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412260112 | NA | 9.21E-08 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 3.65E-07 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 2.01E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 1.89E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 7.33E-06 | mr1525 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 8.43E-09 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | 1.55E-07 | 1.53E-19 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | 7.75E-08 | 2.35E-15 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 7.18E-08 | mr1317_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 1.96E-07 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 5.81E-08 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 1.34E-07 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 6.72E-13 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 1.25E-09 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 3.50E-26 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412260112 | NA | 4.28E-21 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |