Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412235189:

Variant ID: vg0412235189 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12235189
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGAGTGAAGTGAGTTCCTCCTTTTATAGCAGCTCAATGACGGTTGTAGATCGGTTGTTAAGTCGATAAACACTCCTATCGTCATTGGGAACCTGATAG[G/T]
GAGGCACCACGTGGAAGTCGGTGGCCGGGAGCACCAAGGCTGCCAGGCCACCACCTTCAGCCACCAACCTTTCCTTGGTGAGGCTGAAAAGTGGCCGTTA

Reverse complement sequence

TAACGGCCACTTTTCAGCCTCACCAAGGAAAGGTTGGTGGCTGAAGGTGGTGGCCTGGCAGCCTTGGTGCTCCCGGCCACCGACTTCCACGTGGTGCCTC[C/A]
CTATCAGGTTCCCAATGACGATAGGAGTGTTTATCGACTTAACAACCGATCTACAACCGTCATTGAGCTGCTATAAAAGGAGGAACTCACTTCACTCACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 4.70% 1.95% 0.28% NA
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 79.40% 14.00% 5.82% 0.86% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.20% 0.43% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 61.40% 25.80% 11.21% 1.56% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 4.10% 0.83% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412235189 G -> DEL N N silent_mutation Average:64.083; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0412235189 G -> T LOC_Os04g21640.1 upstream_gene_variant ; 3070.0bp to feature; MODIFIER silent_mutation Average:64.083; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0412235189 G -> T LOC_Os04g21620.1 downstream_gene_variant ; 1597.0bp to feature; MODIFIER silent_mutation Average:64.083; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0412235189 G -> T LOC_Os04g21620-LOC_Os04g21640 intergenic_region ; MODIFIER silent_mutation Average:64.083; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412235189 NA 4.12E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 6.97E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.55E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 3.01E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 6.45E-06 6.86E-13 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.22E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 2.72E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.19E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 4.42E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 4.67E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.23E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 6.70E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.57E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.00E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 6.63E-07 1.36E-16 mr1013_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.47E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 3.72E-08 6.88E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 8.32E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 2.37E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.88E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 6.23E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 5.20E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.98E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 8.63E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 2.79E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 5.35E-07 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 1.00E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412235189 NA 3.67E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251