\
| Variant ID: vg0412175929 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12175929 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 213. )
TCAACGATTGGCTTGCACTTAGCAACCTATCCGGACAGTCCAACAAGGGGTACAAGGCTTGCACTCACTGTATGGATGAAACAGAAAGTACGTATCTTAA[G/A]
CACTGTAGGAAGGTTGTATACATGGGTCATCGTCGATTCATACTGTTGAAGGCGATGACCCATGTATACATGAATCGACGATGACCCATGTCTACAATAG
CTATTGTAGACATGGGTCATCGTCGATTCATGTATACATGGGTCATCGCCTTCAACAGTATGAATCGACGATGACCCATGTATACAACCTTCCTACAGTG[C/T]
TTAAGATACGTACTTTCTGTTTCATCCATACAGTGAGTGCAAGCCTTGTACCCCTTGTTGGACTGTCCGGATAGGTTGCTAAGTGCAAGCCAATCGTTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 41.70% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 7.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 1.00% | 98.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 47.60% | 52.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 87.50% | 12.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.10% | 7.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 96.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 52.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412175929 | G -> A | LOC_Os04g21530.1 | synonymous_variant ; p.Lys118Lys; LOW | synonymous_codon | Average:29.828; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412175929 | NA | 3.05E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 1.38E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | 7.08E-06 | 2.96E-07 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 5.23E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 5.31E-52 | mr1795 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 1.71E-15 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 2.48E-17 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 1.08E-53 | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | 7.36E-06 | 4.65E-08 | mr1203_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 8.32E-57 | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | 3.94E-06 | 1.44E-06 | mr1402_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 1.42E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 3.97E-09 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412175929 | NA | 2.98E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |