\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412175142:

Variant ID: vg0412175142 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12175142
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGGCATATTTGATCTTTAGTCCCGGTTCAAATGCTGTCAGGTCCTGTCAGGCCCCCCGGGATCTTTAGTCCCGGTTGGTACAACCGGGACTAAAGATC[A/G]
TACCTTTAGTCCCGGTTGGTAGATCTCAGGGATCTTTAGCCCCAGTTGGTAACACAAACCGGGACTAAAGTCCCACCCCTATATATATGTCTTCTTCCTC

Reverse complement sequence

GAGGAAGAAGACATATATATAGGGGTGGGACTTTAGTCCCGGTTTGTGTTACCAACTGGGGCTAAAGATCCCTGAGATCTACCAACCGGGACTAAAGGTA[T/C]
GATCTTTAGTCCCGGTTGTACCAACCGGGACTAAAGATCCCGGGGGGCCTGACAGGACCTGACAGCATTTGAACCGGGACTAAAGATCAAATATGCCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 41.30% 2.26% 0.53% NA
All Indica  2759 89.00% 6.70% 3.44% 0.91% NA
All Japonica  1512 0.90% 98.90% 0.20% 0.00% NA
Aus  269 48.70% 50.90% 0.37% 0.00% NA
Indica I  595 98.50% 0.30% 0.17% 1.01% NA
Indica II  465 79.10% 4.10% 15.91% 0.86% NA
Indica III  913 87.60% 12.00% 0.33% 0.00% NA
Indica Intermediate  786 89.20% 6.70% 2.16% 1.91% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.60% 0.40% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 1.04% 0.00% NA
Intermediate  90 42.20% 50.00% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412175142 A -> DEL N N silent_mutation Average:31.706; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0412175142 A -> G LOC_Os04g21530.1 upstream_gene_variant ; 434.0bp to feature; MODIFIER silent_mutation Average:31.706; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0412175142 A -> G LOC_Os04g21520.1 downstream_gene_variant ; 2154.0bp to feature; MODIFIER silent_mutation Average:31.706; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0412175142 A -> G LOC_Os04g21520-LOC_Os04g21530 intergenic_region ; MODIFIER silent_mutation Average:31.706; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412175142 NA 1.32E-55 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 3.21E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 3.44E-39 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 3.91E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 1.45E-54 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 4.04E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 2.50E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 3.71E-59 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 1.97E-65 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 4.32E-73 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 2.73E-59 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 2.41E-34 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 2.82E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 3.89E-60 mr1211_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 3.76E-57 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 4.12E-49 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 1.23E-06 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 1.59E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 3.06E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 1.64E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412175142 NA 1.09E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251